Molecular Vision 2002; 8:185-195 <http://www.molvis.org/molvis/v8/a25/> Received 31 August 2001 | Accepted 14 December 2001 | Published 15 June 2002

Download Reprint

Expressed sequence tag analysis of adult human iris for the NEIBank Project: Steroid-response factors and similarities with retinal pigment epithelium

Graeme Wistow,¹ Steven L. Bernstein,² Sugata Ray,¹ M. Keith Wyatt,¹ Amita Behal,¹ Jeffrey W. Touchman,³ Gerard Bouffard,³ Don Smith,¹ Katherine Peterson¹
 
 

¹Section on Molecular Structure and Function, National Eye Institute, National Institutes of Health, Bethesda, MD; ²Departments of Ophthalmology and Neurobiology & Genetics, University of Maryland School of Medicine, Baltimore, MD; ³NIH Intramural Sequencing Center, Gaithersburg, MD

Correspondence to: Graeme Wistow, Ph.D., Chief, Section on Molecular Structure and Function, National Eye Institute, Building 6, Room 331,National Institutes of Health, Bethesda, MD, 20892-2740; Phone: (301) 402-3452; FAX: (301) 496-0078; email: graeme@helix.nih.gov

Abstract

Purpose: The iris is a specialized tissue with important roles in the development and function of the eye. It is involved in diseases, including glaucoma and ocular melanoma, and its pigmented cells share an origin with the retinal pigment epithelium (RPE). Expressed sequence tag (EST) analysis of human iris has been performed to explore the repertoire of genes expressed in this tissue.

Methods: An unamplified, un-normalized cDNA library (designated bx) was constructed from pooled (4-80 years old) human iris tissue. Over 2000 clones were picked and sequenced. Sequences were analyzed and clustered using GRIST (GRouping and Identification of Sequence Tags). The library was then normalized (and designated fg) and a further 2200 clones were sequenced for deeper examination of rarer sequence. Some sequences of interest were investigated further by standard methods.

Results: From bx and fg libraries respectively, 1263 and 1604 clusters of expressed genes have been identified, giving a combined total of almost 2700 potentially unique genes. The most abundant novel transcript in bx is oculoglycan/opticin. Others include glucocorticoid induced leucine zipper protein (GILZ), Ris, a novel member of the Ras family, Iris Ring Finger (IRF), a member of the midline family, melastatin 2 (MLSN2), a member of the transient receptor potential calcium channel family, and iris expressed growth factor (IEGF), a member of the VEGF/PDGF family. Several factors involved in steroid responses are also represented.

Conclusions: The iris libraries are a rich source of novel as well as known genes, including molecular markers for pigmented cells that are also shared with RPE. A number of transcripts code for proteins involved in steroid response, with interesting implications for control of intraocular pressure. These sequence verified clones provide a nonredundant set for micro-array construction.

Introduction

The iris is a distinctive and familiar feature of human appearance. It has a major mechanistic role in the eye, controlling the amount of light that reaches the retina by contracting or relaxing in response to ambient light levels. In addition, pigment in the iris helps to reduce glare in the eye. The iris also serves a structural role in the eye as a physical delineator of the anterior segment. Anteriorly, it provides a large surface area in contact with the aqueous humor, and as such it is ideally located to affect intraocular pressure. Indeed, recent results from a mouse model have linked stromal atrophy and pigment dispersion in the iris with glaucoma [1]. Posteriorly, the iris epithelium contributes in a similar way to the anterior chamber, a space enclosing the proliferative zone of the epithelial cells of the lens. Growth factors secreted into the anterior chamber are thought to contribute to the processes of lens growth by triggering the processes that lead to the proliferation, migration and eventual differentiation of lens epithelial cells into fibers [2]. The identity of factors involved in this signaling is not yet known.

The iris is a pigmented tissue and its characteristic colors derive from the degree of pigmentation. Iris pigment epithelium cells (IPE) share a developmental origin with the better known retinal pigment epithelium (RPE) cells and it has been proposed that IPE cells may be able to serve as autologous replacements for RPE in cell transplants aimed at treating retinal degenerative diseases [3]. The iris also contains melanocytes of neural crest derivation and is one of the ocular tissues afflicted by melanoma [4].

The iris contains several other cell types, including epithelial and muscle cells and nerves of parasympathetic origin. Relatively little is known about the molecular markers associated with any of these cell types in the iris. The iris shares developmental and anatomical features with the neighboring ciliary body. The iris epithelium is a continuation of the ciliary epithelium while the non-pigmented layer of the ciliary epithelium becomes pigmented in the iris. The pigmented ciliary epithelium, a continuation of the RPE, is continuous with the iris epithelium. Some molecular analysis of human ciliary body has been performed and 289 ESTs derived from a subtracted human ciliary body cDNA library [5,6] have been deposited in the dbEST section of GenBank.

Expressed sequence tag (EST) analysis is a powerful tool for probing the molecular repertoire of tissues and cell type. NEIBank is a project aimed at expanding the database of genes expressed in regions of the eye [7]. Here we describe the initial results of EST analysis of a cDNA library made from pooled human iris tissue. The unamplified, un-normalized library (bx) gives an estimation of abundantly expressed genes. It also tends to reveal cDNAs that may be selectively lost through library manipulations such as amplification because of poor growth characteristics in bacterial hosts. The normalized version of the same library (fg) loses abundance information, but has the potential for deeper penetration of the rarer transcripts.

This paper will summarize some of the basic findings from the ongoing analyses of these libraries. Additional sequences and annotation will be added to NEIBank as the project continues. Clones from all the NEIBank libraries are being compiled in a large nonredundant set for construction of human eye cDNA microarrays.

Methods

Tissue and RNA preparation

Human post-mortem irises were obtained under University of Maryland School of Medicine IRB exemptions SB-019701 and SB-129901. Total RNA was extracted using RNAzol or TRIzol (Tel-Test Inc., Friendswood, TX). PolyA RNA was prepared using an oligo(dT) cellulose affinity column [8]. Tissue was pooled from 10 individuals ranging in age from 4-80 years and RNA was extracted. From this pooled sample an aliquot of 60 μg of total RNA yielded 2.17 μg of mRNA.

cDNA library construction, sequencing, and bioinformatics

A directionally cloned cDNA library in the pCMVSPORT6 vector was constructed at Life Technologies (Rockville, MD; now part of Invitrogen Corp.) [9]. For this library, cDNA inserts were cloned into the NotI/EcoRV sites of the vector. Normalization was also performed using a self subtraction procedure based on hybridization of biotinylated single strand RNA copies of the clones with single strand DNA copies [9].

Sequencing was performed at the NIH Intramural Sequencing Center (NISC). Sequences were grouped and identified using GRouping and Identification of Sequence Tags (GRIST; [10]). Sequences were also analyzed using public genome resources at the National Center for Biotechnology Information (NCBI) and the Human Genome Project. Protein motifs were searched using GenomeNet, the NCBI, and the Swiss Institute of Bioinformatics, using the Pfam [11] and Smart [12] databases of motif sequences. Transmembrane helix and signal peptide prediction was performed using the TMHMM server. Cladistic analysis used the program MEGA2 [13]. For this procedure, gaps and missing data were handled by pair-wise deletion, Poisson correction was applied and the UPGMA option was used to generate trees of related sequences.

RH mapping

For some clones, chromosomal location was not immediately apparent from the databases. Radiation hybrid mapping for selected genes was performed at Research Genetics (Huntsville AL), using the Stanford G3 panel (Stanford Human Genome Center, Stanford, CA). PCR primers were designed from the 3' UTR of each sequence, a region unlikely to be interrupted by introns in the genome. PCR was used to amplify unique marker sequences from a total of 83 clones and two controls. An email server operated by the Stanford Human Genome Center was used to link the marker to more than 15000 framework markers. For clone bx2h05 (IEGF) primers used were CTTCTCCCTTGGTTACCTGTT and TAATTTGTACGGCCAGCTTTT. For clone bx05f09 (Ris), primers used were AGCAAGAAAAGGCTGTCCAA and TCTGACCTCAGCTCCTCCAT.

Results & Discussion

Libraries

The bx unamplified, un-normalized library in pCMVSPORT6 contains 6.4x10⁶ primary recombinants with an average insert size of 1.5 kbp. The average length of high quality sequence reads is 480 bp. The content of empty vector clones is 0%, while clones containing mitochondrial genome represent 7% and rRNA 0.5% of the total. For the normalized version of the library, fg, the insert size is unchanged while rRNA content is 0.4%. As one measure of the effect of normalization, the content of cDNA for elongation factor 1α(EF1α) is 93 fold lower in fg than in bx. The full listing of clones obtained from these iris libraries can be found at NEIBank.

Abundant cDNAs: similarities with RPE

While cDNAs from lens are dominated by the characteristic lens crystallins [9], the most abundant clones in the bx unamplified iris library are typical of other tissues, including the stress protein apolipoprotein J, EF1α, ribosomal protein L3, and glyceraldehyde-3-phosphate dehydrogenase (Table 1). The anti-oxidation enzyme plasma glutathione peroxidase 3 (GP3) is ranked third in abundance with 36 copies. The iris is subject to variety of oxidative stresses; the tissue is exposed to sunlight and there are high levels of hydrogen peroxide in the aqueous humor [14,15]. GP3 may be part of a defense mechanism to protect the iris from oxidative damage. The high level of GP3 expression may also be related to the pigment epithelial cells of the iris, since the enzyme is also highly abundant (the second ranking transcript) in the NEIBank RPE/choroid sequence dataset [16].

Transcripts for another enzyme, prostaglandin D2 synthetase (PDS), are represented by 12 ESTs in the bx sequence collection. This is consistent with animal studies that have shown high levels of this enzyme in iris and have implicated prostaglandin D in control of intraocular pressure [17,18], and suggests that PDS is similarly abundant in human iris. PDS is also abundant in RPE/choroid [16] and in lens [9], where it could also be contributing to prostaglandin D levels in the aqueous. Both GP3 and PDS are also expressed in ciliary body [5].

The most abundant novel cDNA discovered in the unamplified iris library ranks at equal fifth position. This codes for a protein known as oculoglycan or opticin (Optc), a member of the small leucine rich repeat proteoglycan (SLRP) superfamily [19]. This has been described in detail elsewhere [20] and has been independently observed by two other groups [21,22]. Optc is a secreted protein, found at high levels in the vitreous [21] and, like other members of its superfamily, probably has a specific binding function. However, although molecular modeling of Optc has been performed [20], no ligand has yet been identified. In yet another similarity between iris and RPE, Optc is also abundant in the RPE/choroid cDNA library [16]. The OPTC gene maps to human chromosome 1q31 in the region of two inherited retinal degenerations disorders (ARMD1 and AXPC1) [20], but no connection with either of these diseases has yet been demonstrated.

The bx library also contains clones for a number of genes that have been positively identified as the loci of inherited eye diseases. These include myocilin, which is mutated in inherited open angle glaucoma and is thought to play a key role in the trabecular meshwork [23,24], TIMP3, which is mutated in Sorsby fundus dystrophy [25], and CYP1B1, the locus of infantile glaucoma 3 [26]. Again, all three of these genes are also expressed in the RPE/choroid [16].

Pigment cell markers and a novel gene, MLSN2

As expected, markers for pigment cells are prominent in the library. The most abundant of these is Pmel17, the homolog of the locus for the mouse silver mutation [27,28], which is represented by eight ESTs. Other markers include the enzymes tyrosinase related protein 1 and dopachrome delta-isomerase, tyrosine related protein 2 and two antigens associated with melanoma or melanocytes, melan-A and CD63 antigen (melanoma 1 antigen).

In addition to these known genes, the bx sequence collection contains a novel transcript related to a gene associated with suppression of melanoma. This cDNA (bx18g11) has weak but significant similarity in predicted protein sequence with melastatin (MLSN1), a member of the family of transient receptor potential calcium channel proteins that is expressed in melanocytes and whose expression is inversely correlated with risk for metastasis in melanoma [29,30]. From the family relationship, the new transcript from iris was designated melastatin 2 (MLSN2).

The clone for MLSN2 was completely sequenced (GenBank Accession: AF325212). It is 1274 bp in length, with a 5' open reading frames (ORF) of 1019 bp (Figure 1). Compared with the original published sequence of MLSN1, MLSN2 initially appeared to be full length at the 5' end. However it now seems that both sequences are incomplete since a much longer ORF for MLSN1 has now been identified (GenBank Accession: XM_007662). At the time of writing, there are four other anonymous ESTs for MLSN2 in Unigene cluster Hs.287445, three derived from embryonic head and one from a CGAP kidney library. Comparisons of MLSN1, MLSN2, and the related transcripts in Unigene and GenBank suggest that members of the family may undergo extensive alternative splicing. Search of current builds of the human genome locates the MLSN2 gene on human chromosome 9p13, close to PAX5, and distinct from the location of MLSN1 on chromosome 15. Further analyses of MLSN2 and its expression in eye and uveal melanoma are in progress. Interestingly, a partial cDNA for MLSN2 is also present in the EST collection from adult lens [9], suggesting that the function of this gene may not be limited to pigmented tissues.

Transcription factors: a steroid response connection?

Table 2 lists the transcription factors identified so far from the combined bx and fg library datasets. At the cDNA level, the most abundant transcription factor in the bx dataset is transforming growth factor β-stimulated protein (TSC-22), a leucine zipper protein [31], which is represented by four ESTs. Interestingly, TSC-22 is related to a protein in Drosophila, called shortsighted or bunched, that is involved in eye development [32,33]. In addition, the bx collection also contains a single EST (bx18e04) that apparently encodes a novel relative of TSC-22, the homologue of mouse glucocorticoid induced leucine zipper protein (GILZ) [34]. This clone was completely sequenced (GenBank Accession: AF183393) and was found to contain a 2023 bp full length sequence (Figure 2). The gene is located on human chromosome Xq22.3 in current human genome assemblies. Both TSC-22 and human GILZ are also expressed in human RPE/choroid [16].

Two cDNAs for another steroid related transcription factor, sterol regulatory element binding transcription factor 1 (SREBF1), were also found in the bx library, while C/EBPδ, a transcription factor that is induced by and mediates the effects of glucocorticoids [35] is represented by two ESTs in the normalized iris (fg) sequence collection. Glucocorticoids and other steroids have major effects on intraocular pressure and a connection between open angle glaucoma and glucocorticoids has been suggested [36,37], so the presence in iris of transcription factors responsive to these agents could have clinical significance. SREBF1 is also found in lens [9], but interestingly is not represented in the large collection of ESTs from RPE/choroid [16]. This could reflect an anterior segment role for this gene and mark a distinction between iris and RPE. Other steroid related transcription regulators found in iris include glucocorticoid receptor repression factor 1 (GRF-1) and sterol regulatory element binding protein (Table 2).

Some of the transcription-related clones may reflect the neural ectoderm and neural crest origins of different populations of iris cells. One novel EST, bx06e07, contains a partial ORF that is 79% identical in protein sequence to cKr2, a C2H2 zinc-finger transcription factor from chicken that is associated with developing neural crest cells [38] (Figure 3). The similarity is sufficient to suggest that bx06e07 represents the human homolog of the chicken gene (hKr2). Given the neural crest origins of IPE cells, this gene clearly merits further study. The gene for hKr2 can be detected in human genome sequence on chromosome 19q13.42. Interestingly, a retinitis pigmentosa locus, RP11, is also mapped to 19q13.4 [39].

Another clone that may encode a neural lineage transcription factor is found in the normalized iris fg sequence collection. Clone fg10a12 contains an ORF which has 98% identity in protein sequence with HES-5, a basic region helix-loop-helix (bHLH) transcription factor that shows preferred expression in neural cell types in the developing mouse [40] and appears to be part of the Notch signaling pathway [41]. It seems likely that fg10a12 is a full length clone for human HES-5.

Cytoskeleton and muscle

Many cell types in the eye have highly organized structures and are, consequently, highly dependent on cytoskeletal proteins. Iris, in addition, is a contractile tissue and contains muscle cells. As shown in Table 3, the iris expresses a wide repertoire of cytoskeleton and muscle related proteins, including regulatory factors (such as GTPases), filament and muscle fiber proteins (actins, myosins, tropomyosins etc) and proteins that connect cytoskeleton to junctions and other cell components (such as catenins, coronin, talin, etc.).

IRF: a novel ring finger protein

During the analysis of potentially novel clones from the bx collection, one (bx04e11) was found to contain an ORF with significant similarity to midline cerebellar isoform protein 1 (MID1), the locus of Optiz syndrome [42]. MID1 is a RING finger protein with an important role in midline development and has been shown to be associated with microtubules [43]. The new MID1 related cDNA was completely sequenced and given the name Iris RING Finger (IRF; GenBank accession number AF353673). A sequence search of the human genome locates this gene on chromosome 1p36.11, divided into eight exons. Analysis of the predicted protein sequence of IRF for conserved motifs shows, as expected, that it contains an N-terminal RING finger domain (a C3HC4 type zinc finger), a B-box zinc finger/coiled-coil (BBCC) region, which is commonly associated with the RING domain [44] (Figure 4). It also contains a C-terminal glutamate rich region of unknown function. RING fingers and BBCC domains are thought be involved in protein interactions and are found in a variety of proteins, including several transcription factors [44]. While this work was in preparation, MURF-1, a protein identical to IRF, was independently described and shown to bind the giant myofibrillar protein titin [45], suggesting that IRF/MURF-1 may have a role in the contractile properties of the iris.

GTP binding proteins: Ris, a novel Ras-like cDNA

Small GTP binding proteins, including Ras, Rho, and other families, act as switches in many of the most important cellular processes, including signal transduction and organization of intracellular structures [46]. These proteins in turn are regulated by guanine exchange factors (GEF) that catalyze the removal of GDP and the regeneration of the active GTPase [47]. Both classes of protein are represented in the iris cDNA collection, and some of those that are associated with actin assembly are listed in Table 3. One EST (bx05f09) contains a complete ORF for a novel member of the Ras family (Pfam accession number 00071). From its origin in iris, this new family member has been given the name Ris. The clone has been completely sequenced (Figure 5). It contains a cDNA insert of 2.5 kbp with an ORF of 801 bp and a long 3' UTR of over 1.5 kbp.

RH mapping was used to map Ris in the human genome. Using the Stanford G3 panel, this showed tight linkage to locus SHGC-33583 (LOD score 16), corresponding to human chromosome 15q22.3. Subsequently, human genome sequence data confirmed this location and shows that the gene is divided into five exons, with the 2 kbp fifth exon accounting for most of the transcribed sequence. ESTs for Ris, originating from several different cDNA libraries, are found in Unigene cluster Hs.27018. Several of these ESTs come from brain and kidney, while most others are derived from tumor cell libraries, particularly from prostate. Considering the apparent expression pattern of Ris, it is interesting that the location of the gene for Ris is similar to that of Bardet-Biedl syndrome (BBS) type 4 (OMIM: 600374), a condition that involves pigmentary retinopathy of the eye in addition to mental retardation and renal failure.

A novel protein potentially related to another part of the small GTP binding protein switch system was also identified. Clone bx14e01 contains an ORF closely related to the mouse neural protein NPDC-1 (neural proliferation, differentiation, and control gene 1) [48]. The complete insert of the human NPDC-1 clone is 1376 bp in length and contains an ORF of 978 bp encoding a protein of 34 kDa (Figure 6). Human NPDC-1 protein contains putative signal sequence and transmembrane regions (Figure 6). It also contains an NCH domain, a conserved structure common to CAB-1, a protein in C. elegans that regulates activity in neural cells through interaction with a GEF protein, and to an unnamed Drosophila protein of unknown function [49]. It is possible that proteins of this class provide a link between GTPase switch pathways and other cellular processes [49]. The NPDC-1 gene can be found in the human genome assemblies on chromosome 9q34.3, divided into nine exons.

Growth factors

Growth factors in the iris and ciliary body have the potential to influence the development and health of other tissues in the anterior compartment of the eye. For example, the growth of the eye lens is broadly under the control of two growth factor related mechanisms [2]. Factors in the vitreous, probably secreted from the retina, control the differentiation of lens epithelial cells into elongated fiber cells. Members of the FGF family and other factors have been implicated in this process [2]. A second mechanism controls the proliferation and migration of lens epithelial cells. This is thought to involve a factor, so far unidentified, that is expressed in iris/ciliary body and secreted in the anterior chamber. Growth factors in the anterior segment of the eye may also influence wound healing, angiogenesis, and other important processes in surrounding tissues, including the cornea.

Vascular endothelial growth factor (VEGF), platelet derived growth factor, and related proteins, form an important superfamily of mitogenic factors with specific effects on different cell types. The best understood role for VEGF is in angiogenesis, a critical process in the eye, where disease, injury, or age related neovascularizations of retina, choroid, and cornea are major causes of blindness [50,51]. Two members of the VEGF family, VEGF-A and VEGF-B, are represented in the bx and fg sequence collections (Table 4), as is an inhibitor of VEGF related angiogenesis, pigment epithelium derived factor [52]. No cDNA sequences for PDGF proteins are in the current collection, although PDGF receptor polypeptides are represented.

IEGF, a novel member of the VEGF/PDGF family

The 5' sequence of one novel EST from the human iris library (clone bx02h05) reveals a weak but significant match in predicted protein sequence to proteins of the VEGF family, particularly fallotein or PDGF-C, a protein of unknown function cloned from ovary [53]. From its expression in iris and its sequence relationships, the new family member has been given the name iris expressed growth factor (IEGF). The complete sequence of IEGF was obtained from the EST clone and has been sequenced in its entirety and contains a long 3' UTR of 2.5 kbp but appears to be incomplete at the 5' end. When the iris cDNA was completely sequenced, its 3' UTR revealed identity with members of a Unigene cluster (Hs.112885) that contains several partial cDNA clones from various tissues, including kidney. Using RNA from human kidney as template, the complete 5' end of the IEGF transcript was determined by 5' RACE (rapid amplification of cDNA ends).

Several 5' end clones were sequenced and, when aligned, revealed an in frame alternative splice in the coding sequence. The complete cDNA sequence of IEGF-l is 3729 bp, while IEGF-s is 3711 bp (GenBank Accession numbers AY027517 and AY027518). Both long and short versions of the IEGF mRNA contain ORF differing only by in frame insertion/deletion of 18 bp or 6 codons (Figure 7A). The predicted sizes of the two versions of the protein are 42.7 kDa and 42 kDa.

Initially, the location of the IEGF gene was unknown, so PCR primers designed from the 3' UTR of bx02h05 were used for RH mapping to localize the gene to human chromosome 11q14-21, linked with a LOD score of 13.07 to marker SHGC-8453. Now the position of the gene can be confirmed by human genome project sequence. The IEGF transcript is divided into seven exons on chromosome 11 and it is apparent that the two mRNA splice variants arise from use of alternative 5' splice sites for exon 2 (Figure 7B). After this work had been completed, the ORF sequence for IEGF was independently described under the name spinal cord derived growth factor B [54] and more recently has been described as PDGF-D [55,56].

The predicted amino acid sequence for IEGF contains an N-terminal CUB domain (Pfam accession number 00431), and a C-terminal PDGF-like growth factor domain (Smart:PDGF; Figure 7A). The CUB domain is an immunoglobulin-like structure involved in protein interactions [57]. The small insertion in the long form of IEGF is positioned just N-terminal to the CUB domain in a region with no strong similarity to other proteins. It is unclear what the effect of the insertion might be at the protein level. Predictions of overall charge for the two versions of the protein show little difference, with both of them predicted to have pIs of about 8. With the complete sequence of IEGF in hand, its evolutionary relationships to other growth factors can be examined. Using the phylogeny program MEGA [13] to align the CUB and growth factor domains with those of related proteins, no significant clustering is apparent using a variety of CUB domains from widely diverged families (not shown), but the better conserved growth factor domain gives a robust grouping (Figure 7C). Comparing IEGF with several closely related members of the VEGF and PDGF families, a tree with three branches is obtained, with distinct VEGF and PDGF families and a third family for IEGF and fallotein.

Other growth factor related proteins

Another newly described protein, which like IEGF contains a growth factor related domain and a CUB domain, is also represented in the bx library. Two clones, bx03h02 and bx11a05, encode the apparent human ortholog of the mouse protein SCUBE-1, a factor which contains an epidermal growth factor domain and a CUB domain [58]. Human SCUBE-1 can be localized in human genome sequence on chromosome 22q13.31. Cat-eye syndrome (CES, OMIM: 115470) involves various eye anomalies including coloboma of the iris and aniridia, however this disorder is mapped to 22q11, which would appear to exclude SCUBE-1 as a likely candidate. The iris also contains transcripts for neurotrophin 3, a mitogen for cultured neural crest cells [59], and for two other neurotrophic factors, pleiotrophin and midkine [60].

Comparison with ciliary body ESTs

Given the close relationship between iris and ciliary body, it might be expected that the tissues have similar patterns of gene expression. So, although the sizes of the databases are very different, it is of interest to compare the clones obtained so far from the subtracted ciliary body cDNA library [5] with those of the combined NEIBank (byfg) collection. Clones from the ciliary body collection (CB) have been described in several papers. They include clones coding for several plasma proteins, suggesting that such proteins in the aqueous humor may have an ocular origin [5] and clones for genes involved in neuropeptide synthesis [61]. Some of the iris expressed genes described above, including PDS, GP3, and myocilin have also been detected in CB [5,62].

Surprisingly, when the 289 CB clones are processed through GRIST with the total of over 4000 clones from bx and fg, only 66 of the CB clones (23%) group with iris clones. The remaining 223 clones are not represented in the large un-normalized and normalized collection. Few of the CB sequences are quite short and may not represent true transcripts, but most of the clones have significant matches to GenBank or Unigene sequences and are therefore identifiable genes.

The CB clones are the result of subtraction, which precludes a direct comparison with the iris data, but it is interesting to see how few of even this relatively small set match clones from the iris collection. This may mean that, in spite of the proximity and related origin of the two tissues, there could indeed be significant differences in gene expression between them. However it is more likely that we need larger datasets to allow a full comparison.

Conclusion

The iris cDNA libraries have provided a large and varied set of clones for future studies, including the construction of human eye cDNA microarrays. By itself, the EST analysis has revealed some interesting parallels with gene expression in human RPE [16] and several transcripts that are associated with neural lineages or with the contractile phenotype. Such markers may be useful for work on IPE cells that focuses on their potential for autologous cell transplant in retinal degenerative disease [3].

The sequence collection also contains a number of transcripts that have interesting implications for control of intraocular pressure, including known glaucoma genes, such as myocilin and CYP1B1, and PDS, an enzyme of prostaglandin synthesis. In addition, there are several cDNAs for enzymes and transcription factors that are involved in responses to steroids. A variety of clinical observations suggest links between glucocorticoid induced ocular hypertension and primary open angle glaucoma [37]. Glucocorticoids and other steroids have wide ranging effects, but foremost among their biological functions is their ability to regulate gene transcription to effect cellular process from inflammation to apoptosis [34,63,64]. Among the transcription factors represented in the EST sampling are several which could play a role in this kind of response, including the human homolog of mouse, GILZ (glucocorticoid induced leucine zipper) [34]. Interestingly, GILZ is related in sequence to TSC-22, a TGFβ-induced factor [31], which happens to be the most abundant transcription factor represented in the iris cDNAs. Both these factors are related to shortsighted/bunched, a Drosophila gene that is itself involved in eye development [32,33]. Given the surprising parallels between vertebrate and invertebrate eye developmental pathways [65], this is intriguing and worthy of further investigation.

Acknowledgements

SLB is supported by the V. Kann Rasmussen Foundation (Denmark) and is a Career Development Awardee of Research to Prevent Blindness (RPB). We thank Dr. Weinu Gan for cDNA sequencing and Ray Tabios for technical assistance.

References

1. Chang B, Smith RS, Hawes NL, Anderson MG, Zabaleta A, Savinova O, Roderick TH, Heckenlively JR, Davisson MT, John SW. Interacting loci cause severe iris atrophy and glaucoma in DBA/2J mice. Nat Genet 1999; 21:405-9.

2. McAvoy JW, Chamberlain CG, de Iongh RU, Hales AM, Lovicu FJ. Lens development. Eye 1999; 13:425-37.

3. Thumann G. Development and cellular functions of the iris pigment epithelium. Surv Ophthalmol 2001; 45:345-54.

4. Shields JA, Shields CL, De Potter P, Singh AD. Diagnosis and treatment of uveal melanoma. Semin Oncol 1996; 23:763-7.

5. Escribano J, Ortego J, Coca-Prados M. Isolation and characterization of cell-specific cDNA clones from a subtractive library of the ocular ciliary body of a single normal human donor: transcription and synthesis of plasma proteins. J Biochem (Tokyo) 1995; 118:921-31.

6. Coca-Prados M, Escribano J, Ortego J. Differential gene expression in the human ciliary epithelium. Prog Retin Eye Res 1999; 18:403-29.

7. Wistow G. A project for ocular bioinformatics: NEIBank. Mol Vis 2002; 8:161-3 <http://www.molvis.org/molvis/v8/a22/>.

8. Simms D. mRNA isolation for high quality cDNA. Focus 1995; 17:39-42.

9. Wistow G, Bernstein SL, Wyatt MK, Behal A, Touchman JW, Bouffard G, Smith D, Peterson K. Expressed sequence tag analysis of adult human lens for the NEIBank Project: Over 2000 non-redundant transcripts, novel genes and splice variants. Mol Vis 2002; 8:171-84 <http://www.molvis.org/molvis/v8/a24/>.

10. Wistow G, Bernstein SL, Touchman JW, Bouffard G, Wyatt MK, Peterson K, Gao J, Buchoff P, Smith D. Grouping and identification of sequence tags (GRIST): Bioinformatics tools for the NEIBank database. Mol Vis 2002; 8:164-70 <http://www.molvis.org/molvis/v8/a23/>.

11. Bateman A, Birney E, Durbin R, Eddy SR, Howe KL, Sonnhammer EL. The Pfam protein families database. Nucleic Acids Res 2000; 28:263-6.

12. Schultz J, Copley RR, Doerks T, Ponting CP, Bork P. SMART: a web-based tool for the study of genetically mobile domains. Nucleic Acids Res 2000; 28:231-4.

13. Kumar S, Tamura K, Nei M. MEGA: Molecular Evolutionary Genetics Analysis software for microcomputers. Comput Appl Biosci 1994; 10:189-91.

14. Reddy VN. Glutathione and its function in the lens--an overview. Exp Eye Res 1990; 50:771-8.

15. Spector A, Ma W, Wang RR. The aqueous humor is capable of generating and degrading H2O2. Invest Ophthalmol Vis Sci 1998; 39:1188-97.

16. Wistow G, Bernstein SL, Wyatt MK, Fariss RN, Behal A, Touchman JW, Bouffard G, Smith D, Peterson K. Expressed sequence tag analysis of human RPE/choroid for the NEIBank Project: Over 6000 non-redundant transcripts, novel genes and splice variants. Mol Vis 2002; 8:205-20 <http://www.molvis.org/molvis/v8/a27/>.

17. Gerashchenko DY, Beuckmann CT, Marcheselli VL, Gordon WC, Kanaoka Y, Eguchi N, Urade Y, Hayaishi O, Bazan NG. Localization of lipocalin-type prostaglandin D synthase (beta-trace) in iris, ciliary body, and eye fluids. Invest Ophthalmol Vis Sci 1998; 39:198-203.

18. Goh Y, Nakajima M, Azuma I, Hayaishi O. Prostaglandin D2 reduces intraocular pressure. Br J Ophthalmol 1988; 72:461-4.

19. Iozzo RV. The biology of the small leucine-rich proteoglycans. Functional network of interactive proteins. J Biol Chem 1999; 274:18843-6.

20. Hobby P, Wyatt MK, Gan W, Bernstein S, Tomarev S, Slingsby C, Wistow G. Cloning, modeling, and chromosomal localization for a small leucine-rich repeat proteoglycan (SLRP) family member expressed in human eye. Mol Vis 2000; 6:72-8 <http://www.molvis.org/molvis/v6/a10/>.

21. Reardon AJ, Le Goff M, Briggs MD, McLeod D, Sheehan JK, Thornton DJ, Bishop PN. Identification in vitreous and molecular cloning of opticin, a novel member of the family of leucine-rich repeat proteins of the extracellular matrix. J Biol Chem 2000; 275:2123-9.

22. Friedman JS, Ducharme R, Raymond V, Walter MA. Isolation of a novel iris-specific and leucine-rich repeat protein (oculoglycan) using differential selection. Invest Ophthalmol Vis Sci 2000; 41:2059-66.

23. Stone EM, Fingert JH, Alward WL, Nguyen TD, Polansky JR, Sunden SL, Nishimura D, Clark AF, Nystuen A, Nichols BE, Mackey DA, Ritch R, Kalenak JW, Craven ER, Sheffield VC. Identification of a gene that causes primary open angle glaucoma. Science 1997; 275:668-70.

24. Johnson DH. Myocilin and glaucoma: a TIGR by the tail? Arch Ophthalmol 2000; 118:974-8.

25. Weber BH, Vogt G, Pruett RC, Stohr H, Felbor U. Mutations in the tissue inhibitor of metalloproteinases-3 (TIMP3) in patients with Sorsby's fundus dystrophy. Nat Genet 1994; 8:352-6.

26. Stoilov I, Akarsu AN, Sarfarazi M. Identification of three different truncating mutations in cytochrome P4501B1 (CYP1B1) as the principal cause of primary congenital glaucoma (Buphthalmos) in families linked to the GLC3A locus on chromosome 2p21. Hum Mol Genet 1997; 6:641-7.

27. Adema GJ, de Boer AJ, Vogel AM, Loenen WA, Figdor CG. Molecular characterization of the melanocyte lineage-specific antigen gp100. J Biol Chem 1994; 269:20126-33.

28. Solano F, Martinez-Esparza M, Jimenez-Cervantes C, Hill SP, Lozano JA, Garcia-Borron JC. New insights on the structure of the mouse silver locus and on the function of the silver protein. Pigment Cell Res 2000; 13 Suppl 8:118-24.

29. Duncan LM, Deeds J, Hunter J, Shao J, Holmgren LM, Woolf EA, Tepper RI, Shyjan AW. Down-regulation of the novel gene melastatin correlates with potential for melanoma metastasis. Cancer Res 1998; 58:1515-20.

30. Hofmann T, Schaefer M, Schultz G, Gudermann T. Transient receptor potential channels as molecular substrates of receptor-mediated cation entry. J Mol Med 2000; 78:14-25.

31. Kester HA, Blanchetot C, den Hertog J, van der Saag PT, van der Burg B. Transforming growth factor-beta-stimulated clone-22 is a member of a family of leucine zipper proteins that can homo- and heterodimerize and has transcriptional repressor activity. J Biol Chem 1999; 274:27439-47.

32. Treisman JE, Lai ZC, Rubin GM. Shortsighted acts in the decapentaplegic pathway in Drosophila eye development and has homology to a mouse TGF-beta-responsive gene. Development 1995; 121:2835-45.

33. Dobens LL, Hsu T, Twombly V, Gelbart WM, Raftery LA, Kafatos FC. The Drosophila bunched gene is a homologue of the growth factor stimulated mammalian TSC-22 sequence and is required during oogenesis. Mech Dev 1997; 65:197-208.

34. Riccardi C, Cifone MG, Migliorati G. Glucocorticoid hormone-induced modulation of gene expression and regulation of T-cell death: role of GITR and GILZ, two dexamethasone-induced genes. Cell Death Differ 1999; 6:1182-9.

35. Yeh WC, Cao Z, Classon M, McKnight SL. Cascade regulation of terminal adipocyte differentiation by three members of the C/EBP family of leucine zipper proteins. Genes Dev 1995; 9:168-81.

36. Wordinger RJ, Clark AF. Effects of glucocorticoids on the trabecular meshwork: towards a better understanding of glaucoma. Prog Retin Eye Res 1999; 18:629-67.

37. Fingert JH, Clark AF, Craig JE, Alward WL, Snibson GR, McLaughlin M, Tuttle L, Mackey DA, Sheffield VC, Stone EM. Evaluation of the myocilin (MYOC) glaucoma gene in monkey and human steroid-induced ocular hypertension. Invest Ophthalmol Vis Sci 2001; 42:145-52.

38. Schutz B, Niessing J. Cloning and structure of a chicken zinc finger cDNA: restricted expression in developing neural crest cells. Gene 1994; 148:227-36.

39. Al-Maghtheh M, Vithana E, Tarttelin E, Jay M, Evans K, Moore T, Bhattacharya S, Inglehearn CF. Evidence for a major retinitis pigmentosa locus on 19q13.4 (RP11) and association with a unique bimodal expressivity phenotype. Am J Hum Genet 1996; 59:864-71.

40. Takebayashi K, Akazawa C, Nakanishi S, Kageyama R. Structure and promoter analysis of the gene encoding the mouse helix-loop-helix factor HES-5. Identification of the neural precursor cell-specific promoter element. J Biol Chem 1995; 270:1342-9.

41. Kageyama R, Ohtsuka T. The Notch-Hes pathway in mammalian neural development. Cell Res 1999; 9:179-88.

42. Quaderi NA, Schweiger S, Gaudenz K, Franco B, Rugarli EI, Berger W, Feldman GJ, Volta M, Andolfi G, Gilgenkrantz S, Marion RW, Hennekam RC, Opitz JM, Muenke M, Ropers HH, Ballabio A. Opitz G/BBB syndrome, a defect of midline development, is due to mutations in a new RING finger gene on Xp22. Nat Genet 1997; 17:285-91.

43. Schweiger S, Foerster J, Lehmann T, Suckow V, Muller YA, Walter G, Davies T, Porter H, van Bokhoven H, Lunt PW, Traub P, Ropers HH. The Opitz syndrome gene product, MID1, associates with microtubules. Proc Natl Acad Sci U S A 1999; 96:2794-9.

44. Borden KL. RING fingers and B-boxes: zinc-binding protein-protein interaction domains. Biochem Cell Biol 1998; 76:351-8.

45. Centner T, Yano J, Kimura E, McElhinny AS, Pelin K, Witt CC, Bang ML, Trombitas K, Granzier H, Gregorio CC, Sorimachi H, Labeit S. Identification of muscle specific ring finger proteins as potential regulators of the titin kinase domain. J Mol Biol 2001; 306:717-26.

46. Takai Y, Sasaki T, Matozaki T. Small GTP-binding proteins. Physiol Rev 2001; 81:153-208.

47. Cherfils J, Chardin P. GEFs: structural basis for their activation of small GTP-binding proteins. Trends Biochem Sci 1999; 24:306-11.

48. Galiana E, Vernier P, Dupont E, Evrard C, Rouget P. Identification of a neural-specific cDNA, NPDC-1, able to down-regulate cell proliferation and to suppress transformation. Proc Natl Acad Sci U S A 1995; 92:1560-4.

49. Iwasaki K, Toyonaga R. The Rab3 GDP/GTP exchange factor homolog AEX-3 has a dual function in synaptic transmission. EMBO J 2000; 19:4806-16.

50. Campochiaro PA. Retinal and choroidal neovascularization. J Cell Physiol 2000; 184:301-10.

51. Moromizato Y, Stechschulte S, Miyamoto K, Murata T, Tsujikawa A, Joussen AM, Adamis AP. CD18 and ICAM-1-dependent corneal neovascularization and inflammation after limbal injury. Am J Pathol 2000; 157:1277-81.

52. Dawson DW, Volpert OV, Gillis P, Crawford SE, Xu H, Benedict W, Bouck NP. Pigment epithelium-derived factor: a potent inhibitor of angiogenesis. Science 1999; 285:245-8.

53. Tsai YJ, Lee RK, Lin SP, Chen YH. Identification of a novel platelet-derived growth factor-like gene, fallotein, in the human reproductive tract. Biochim Biophys Acta 2000; 1492:196-202.

54. Hamada T, Ui-Tei K, Imaki J, Miyata Y. Molecular cloning of SCDGF-B, a novel growth factor homologous to SCDGF/PDGF-C/fallotein. Biochem Biophys Res Commun 2001; 280:733-7.

55. Bergsten E, Uutela M, Li X, Pietras K, Ostman A, Heldin CH, Alitalo K, Eriksson U. PDGF-D is a specific, protease-activated ligand for the PDGF beta-receptor. Nat Cell Biol 2001; 3:512-6.

56. LaRochelle WJ, Jeffers M, McDonald WF, Chillakuru RA, Giese NA, Lokker NA, Sullivan C, Boldog FL, Yang M, Vernet C, Burgess CE, Fernandes E, Deegler LL, Rittman B, Shimkets J, Shimkets RA, Rothberg JM, Lichenstein HS. PDGF-D, a new protease-activated growth factor. Nat Cell Biol 2001; 3:517-21.

57. Bork P, Beckmann G. The CUB domain. A widespread module in developmentally regulated proteins. J Mol Biol 1993; 231:539-45.

58. Grimmond S, Larder R, Van Hateren N, Siggers P, Hulsebos TJ, Arkell R, Greenfield A. Cloning, mapping, and expression analysis of a gene encoding a novel mammalian EGF-related protein (SCUBE1). Genomics 2000; 70:74-81.

59. Kalcheim C, Carmeli C, Rosenthal A. Neurotrophin 3 is a mitogen for cultured neural crest cells. Proc Natl Acad Sci U S A 1992; 89:1661-5.

60. Nakagawara A, Milbrandt J, Muramatsu T, Deuel TF, Zhao H, Cnaan A, Brodeur GM. Differential expression of pleiotrophin and midkine in advanced neuroblastomas. Cancer Res 1995; 55:1792-7.

61. Ortego J, Escribano J, Crabb J, Coca-Prados M. Identification of a neuropeptide and neuropeptide-processing enzymes in aqueous humor confers neuroendocrine features to the human ocular ciliary epithelium. J Neurochem 1996; 66:787-96.

62. Ortego J, Escribano J, Coca-Prados M. Cloning and characterization of subtracted cDNAs from a human ciliary body library encoding TIGR, a protein involved in juvenile open angle glaucoma with homology to myosin and olfactomedin. FEBS Lett 1997; 413:349-53.

63. Barnes PJ, Adcock I. Anti-inflammatory actions of steroids: molecular mechanisms. Trends Pharmacol Sci 1993; 14:436-41.

64. Planey SL, Litwack G. Glucocorticoid-induced apoptosis in lymphocytes. Biochem Biophys Res Commun 2000; 279:307-12.

65. Treisman JE. A conserved blueprint for the eye? Bioessays 1999; 21:843-50.

Typographical corrections