Molecular Vision 2000; 6:72-78 <http://www.molvis.org/molvis/v6/a10/> Received 3 April 2000 | Accepted 10 May 2000 | Published 12 May 2000

Download Reprint

Cloning, modeling, and chromosomal localization for a small leucine-rich repeat proteoglycan (SLRP) family member expressed in human eye

Paul Hobby,¹ M. Keith Wyatt,² Weinu Gan,³ Steven Bernstein,⁴ Stanislav Tomarev,² Christine Slingsby,¹ Graeme Wistow²
 
 

¹Department of Crystallography, Birkbeck College, Malet Street, London, UK; ²National Eye Institute, National Institutes of Health, Bethesda, MD, USA; ³NIH Intramural Sequencing Center, Gaithersburg, MD, USA; ⁴Department of Ophthalmology, University of Maryland School of Medicine, Baltimore, MD, USA

Correspondence to: Graeme Wistow, Ph.D., Section on Molecular Structure and Function, National Eye Institute, Bldg 6, Rm 331, National Institutes of Health, Bethesda, MD, 20892-2740; Phone: (301) 402-3452; FAX: (301) 496-0078; email: graeme@helix.nih.gov

Abstract

Purpose: To examine a highly abundant novel transcript from human iris.

Methods: Expressed sequence tag (EST) analysis of an adult human iris cDNA library revealed an abundant (>0.7%) transcript for a novel member of the small leucine-rich proteoglycan (SLRP) family. Other 3' ESTs from retina were also detected in dbEST. The structure of the leucine-rich repeat (LRR) domain was investigated by molecular modeling. Antisera were raised against a specific peptide and used in western blots of human and rat eye tissues.

Results: From its prevalence in the eye and its superfamily relationships, this SLRP protein has been given the names oculoglycan or opticin (Optc). Sequence analysis suggests that Optc has a signal peptide and two structural domains, the larger of which is the LRR domain. Modeling of the LRR domain reveals structural variability in the repeat motifs, forming potential interaction sites for binding partners. Antiserum to a specific peptide detected a protein of approximately 48 kDa, in human iris, ciliary body and retina while the major protein detected in rat ocular tissues was 37 kDa in size. This may reflect a species difference in post-translational modification. Radiation hybrid mapping shows that the gene for OPTC is located on chromosome 1q31, close to the inherited eye diseases ARMD1 and AXPC1.

Conclusions: Optc is a newly identified SLRP family member, which appears to have eye-preferred expression. Molecular modeling reveals local deviations from the familiar LRR structure, which are candidates for specific interaction sites. Western blotting with a specific peptide antibody detects Optc in iris, ciliary body and retina in the human eye and suggests that the protein is post-translationally modified. In rat, the antibody detects Optc in several eye tissues and in brain but the protein appears to have undergone much less modification, suggesting that this is not essential for all aspects of function. Considering its eye-preferred expression, the OPTC gene has the potential for involvement in inherited eye disease. Indeed, it maps close to at least two disease loci for which no gene has so far been identified.

Introduction

As part of a project called NEIBANK, cDNA libraries for tissues of the human eye that have been unrepresented or poorly represented in previous expressed sequence tag (EST) analyses have been constructed and sequenced. One of these libraries is for human iris, a pigmented, contractile tissue extending from the ciliary body. A primary function of the iris is to define the pupil and thereby to regulate light entering the eye. The iris also has extensive surface interactions with the anterior and posterior chambers of the eye, allowing it to participate in the maintenance and pressure of ocular fluids. Here we describe a highly abundant transcript discovered through EST analysis of the iris library. It encodes a protein, known as oculoglycan or opticin (Optc), that has the hallmarks of a secreted protein belonging to the family of small leucine-rich proteoglycans (SLRP), proteins containing domains consisting of leucine-rich repeats (LRR) [1]. The LRR is a molecular recognition motif found in proteins with roles in cell adhesion, signal transduction, DNA repair, and RNA processing. This may include modulation of the effects of growth factors, such as TGFb1, through binding in the extracellular matrix. Other SLRPs are involved in maintenance and growth of diverse tissues, including cornea, bones, teeth, skin, tendons, and blood vessels.

Methods

cDNA clones

A cDNA library for human iris (mixed ages from 4 to 40 years), was constructed in pCMVSPORT6 (Life Technologies, Rockville, MD). The un-normalized library was subjected to EST analysis by 5' sequencing of over 2000 clones. For EST sequencing, individual clones were inoculated in 1.2 ml of Terrific Broth (Quality Biological Inc., Gaithersburg, MD) containing 100 mg/ml ampicillin (in a 2-ml well of a 96-well plate) and incubated with agitation at 37 °C for 20-24 h. Plasmid DNA was prepared using an alkaline lysis method and DNA was suspended in 50 ml of TE (10 mM Tris-HCL, pH 7.5; 0.1 mM EDTA). Fluorescent DNA sequencing reactions were performed using M13 forward (GTTTTCCCAGTCACGAC) or reverse (CAGGAAACAGCTATGACC) primers and BigDye terminator sequencing kit (PE Applied Biosystems, Foster City, CA). The products were analyzed on ABI 377 automated fluorescent sequencer (PE/Applied Biosystems). Full insert cDNA sequencing was performed on selected clones by a primer-walking sequencing strategy until the sequence of both strands of the cDNA had been determined. The sequence was edited and assembled using the program Sequencher (Gene Codes, Ann Arbor, MI).

RH mapping

Radiation hybrid mapping for OPTC was performed at Research Genetics (Huntsville AL), using the Stanford G3 panel. PCR primers were designed from the 3' UTR of the OPTC cDNA sequence, a region unlikely to be interrupted by introns in the genome. The 5' primer sequence was: TCCCAGGTCATCTCTTGGAC; the 3' primer was: GAAGGGAGACGTGAGAGCTG. This pair generates a unique 153 bp product in human/rodent cell hybrids. PCR was used to amplify the marker sequence from a total of 83 clones and two controls. An e-mail server operated by the Stanford Human Genome Center was used to link the marker to more than 15000 framework markers.

Sequence analysis

Sequences were analyzed using BLAST (National Center for Biotechnology Information, National Library of Medicine, Bethesda, MD), SMART (Simple Modular Architecture Research Tool), and the fold recognition servers 3D PSSM and UCLA-DOE fold recognition server. The sequence was also compared with a Hidden Markov Model (HMM) library for protein structures (Computational Biology homepage, run by the Baskin Center, at the University of Santa Cruz). The isoelectric point was predicted using the Editseq program (DNASTAR, Madison, WI).

Molecular modeling and visualization

Molecular modeling was performed on Silicon Graphics Octane workstations running INSIGHT II and HOMOLOGY (MSI, San Diego, CA). The Optc sequence was aligned with the sequences of ribonuclease inhibitor (RI), the A domain of the U2 B' A' RNA ternary complex (U2A), thyrotropin receptor and follitropin receptor, taking care to align the seven LRR repeat regions within Optc to corresponding regions in the various candidate templates. Optc co-ordinates for the seven structurally conserved LRR regions were directly assigned from the X-ray structure of RI (1DFJ). For the six intervening sequences between LRR repeats of Optc, co-ordinates from several three dimensional structures were considered including the X-ray structures of RI and U2A (1A9N), and the homology models of follitropin receptor (1XUN) and thyrotropin receptor. Kajava and coworkers [2], having analyzed the sequences of 569 LRR repeats from 68 proteins, have proposed likely structural roles of conserved residues allowing construction of plausible models of intervening segments. Some of these segments are present in a model of the thyrotropin receptor, found on the ISREC molecular modeling activities website.

Some three-residue junctional regions were modeled using the three dimensional database conformational search program GENLOOPS, which is part of the HOMOLOGY module. Conformers were acceptable if C-a/C-bbonds of the terminal residues aligned with those of the flanking template residues, the f and y torsional angles were within allowed regions, and the steric interactions with adjacent residues minimal. Interactive adjustment of f/y angles was performed using the Ramachandran plot display in the molecular graphics program SWISSPDB viewer (Glaxo Experimental Research) [3]. Energy minimization of the model was carried out using the program Amber [4]. The program employed the 96 force field and was run for 5000 iterations of the algorithm. The program PROCHECK [5] was run between successive stages of modeling to monitor main-chain and side-chain stereochemistry. Ribbon views of the Optc model were generated using the ribbon display program within INSIGHT II, molecular surfaces were generated using GRASP [6]

Immunochemistry

A potentially antigenic peptide with no close match in the sequence databases was identified. This peptide, CDPEEHKHTRRQ, (residues 289-300) was synthesized at Princeton Biomolecules (Columbus, OH), linked to support matrix through the N-terminal cysteine and used to raise polyclonal antiserum in rabbits. The antiserum, designated OCGp1, was tested in western blot of soluble extracts of human and rat tissues.

Human tissues were collected post-mortem and immediately frozen, under University of Maryland School of Medicine IRB exemptions SB-019701 and SB-129901. For these experiments, human donor age was 80 yr. Tissues were gently homogenized in equal volumes of TE pH 7.5 buffer containing Pefabloc and Complete protease inhibitors (Roche Molecular Biochemicals, Indianapolis, IN), following manufacturer's instructions. Insoluble fractions were removed by centrifugation. Rat tissues were processed in a similar way, homogenized in TE pH 7.5 buffer containing PMSF, leupeptin and pepstatin with 1% NP-40, 1% Triton X-100 and 0.2% SDS. Extracts (approximately 10mg per lane) were separated using SDS PAGE on 14% (human) or 12% (rat) Tris-glycine gels (Novex) and electro-transferred onto nitrocellulose. For human samples, western blotting was performed essentially as described previously [7], using reagents from Vector Labs (Burlingame, CA) and colorimetric visualization using reagents from BioRad (Hercules, CA). For rat samples, similar procedures were employed, using immunochemistry reagents from Amersham Pharmacia Biotech (Piscataway, NJ). Signal was visualized using the Supersignal Pico Chemiluminescence system (Pierce, Rockford IL).

Results & Discussion

cDNA Sequence

A highly abundant, novel transcript was identified by EST analysis of a human iris cDNA library. This transcript accounts for over 0.7% of all cDNAs analyzed, ranking fifth in abundance in the library. One clone (bx04a09) was selected for full-length sequence (GenBank accession AF161702). This cDNA was 1337 nt in length, excluding the poly(A) tail (Figure 1). It contained a single long ORF of 332 codons, predicting an unmodified protein of just over 37 kDa with an overall negative charge and a predicted isoelectric point of 5.4. BLAST searches showed that the clone was not represented in GenBank, but that it showed significant similarity in predicted protein sequence to a large family of small leucine-rich proteoglycans (SLRP) with domains consisting of leucine-rich repeats (LRR) [1], including various vertebrate proteoglycans, epiphycan, osteoglycin and mimecan. In particular, the sequence contains the Cx2CxCx6C motif diagnostic of Class III SLRP [1], although unlike typical members of the class, this sequence contains seven, rather than six, LRR.

Searches against dbEST revealed six 3' EST sequences for the same transcript from human retina. No ESTs have been detected in any non-ocular tissues. The eye-preference and superfamily membership of the new transcript suggested the name Oculoglycan. Since this work was completed and the sequence deposited in GenBank, the same transcript, from retina, has been independently described (GenBank accession AJ133790) and designated Opticin [8]. In this report the oculoglycan/opticin transcript also appears to be eye-preferred, although RT-PCR additionally produced a fragment of the expected size from skin and ligament. In accordance with HUGO nomenclature suggestions we agree to use the name opticin and the symbol OPTC to avoid confusion. At the protein level, opticin (Optc) was observed as a prominent component of bovine vitreous [8].

Fold prediction

Analysis of the Optc amino-acid sequence, using SMART, predicts a signal peptide from 1-21, consistent with a role as a secreted protein. The first domain, residues 22-125, gives no strong prediction, although there is slight similarity to immunoglobulin like domains of two receptors from Geodia cydonium sponge (GenBank accession X98340 and Y18372). The second domain, residues 126-332 is a leucine-rich repeat (LRR) domain of 7 repeats, as described below. This places Optc in a very extensive superfamily, most closely related to osteoinductive factors (bone) and osteoglycin (also found in the anterior segment of the eye). BLAST searches against the Protein Data Bank (PDB) revealed similarity to two LRR proteins, a ribonuclease inhibitor (in complex with angiogenin; pdb: 1A4Y) and the spliceosomal U2 B''-U2A'RNA ternary complex (pdb: 1A9N). The significance values for these matches are not strong, but are noted in the light of subsequent fold recognition studies.

The fold recognition servers 3D PSSM and UCLA-DOE fold recognition server were also used to identify potential templates for modeling. No structural template for domain 1 was found although two templates, a ribonuclease inhibitor and the spliceosomal complex (1DFJ and 1A9N) were again identified for domain 2. The protein structure HMM analysis also suggested ribonuclease inhibitor as a template.

Three Dimensional Modeling of Optc

Although the ribonuclease inhibitor and spliceosomal protein have very little sequence homology with each other, the 11-residue leucine-rich repeat regions of these proteins [9] can be recognized and aligned with corresponding LRR regions in Optc. The 4 LRR repeats of U2A are clearly structurally similar to and superimpose well on LRR repeats of RI. As the homology between Optc and RI is somewhat higher, it was chosen as the primary template for the LRR regions.

RI has a horseshoe solenoid structure in which the 11-residue LRR repeats are separated by intervening sequences of 18 and 17 residues. The LRR includes the b-strands that form the inner rim of the horseshoe as well as those pre- and post-b-strand residues that form its radial surface. The intervening sequences form the outer rim segments of the horseshoe. The co-ordinates for all seven 11-residue LRR repeats of Optc have been assigned directly from RI (labelled A-G in Figure 2 and Figure 3). However, unlike RI, the outer rim segments of Optc vary in length, from 9-22 residues and so other templates were investigated. The sequences of the outer rim segments of Optc were aligned with outer segments from the crystal structure of U2A and the homology models of thyrotropin receptor and follitropin receptor. These molecules have varying numbers of residues in the LRR intervening sequences from which candidate structural templates were selected based on similarity of sequence length and composition. Six template outer segments were sought (labelled in Figure 2 and Figure 3 as A'-F').

The Optc outer segments A' and B' are both 13-residue strands. The 13-residue outer strand B of U2A (CRIGEGLDQALPD) was used as a preliminary template for the Optc A' and B' strands, but was found to be unsuitable for the following reasons. The C-terminal region of the U2A template ends in a widening coil conformation, which causes the two strands to be pushed apart. The result is that the inter-axial distances of the modeled strands do not conform to the uniform distance (1.0 nm) seen in RI or U2A. The separation creates a large hole in the molecule because there is little packing between adjacent residues in the N terminal and middle residues of the A' and B' outer segments. Furthermore, the two phenylalanines in these strands point outwards towards solvent. In the current model, segments A' and B' are based on the first segment of thyrotropin receptor which also has 13 residues and a phenylalanine residue that is topologically equivalent to those in the Optc A' and B' outer segments. When used as a template for Optc outer segments A' and B', it packs much more efficiently with no holes created, and the phenylalanines are pointed inwards.

The Optc outer segment C' has only 9 residues and is too short to form an a-helix or coil. This region was built as far as possible according to the conformational framework suggested by Kajava et al. [2], namely as a-g-bp-bp-a-g-b-a-g. The limiting factor was steric overlap with residues from adjacent segments. Construction of this segment was performed after outer strand D' had been modeled to ensure that the conformational space search would be restricted to a region 2.0 nm wide thus allowing the correct inter-axial distances to be maintained. The outer segment D' of Optc has 15 residues. Although the sixth outer segment of thyrotropin receptor is the same length, when used to model strand D' the positions of key hydrophobics particularly the phenylalanine at position 10 were not ideal. The sequence was therefore threaded one residue along the central 9-residue helix: 3-residue segments at either end were modeled using the conformational search program GENLOOPS.

The Optc outer strand E' has 10 residues and was modeled taking note of the conformational rules devised by Kajava and co-workers [2] and by employing the template from the eighth intervening segment of thyrotropin receptor. The Optc outer strand F' has 20 residues and is thus long enough to form an a-helix. The central fourteen residues of Optc were modeled as an a-helix using the central residues from the 18-residue outer strand of DFJ-E as a template, while the three residues at each end of Optc outer segment were modeled from a conformational search using GENLOOPS.

The final model structure for the LRR domain of Optc is shown in ribbon diagrams in Figure 3A and Figure 3B. Coordinates for the opticin molecule are available in PDB format online (here) and can be viewed directly with the browser/pdb-viewer CHIME.

Surface residues

A shorthand notation for the LRR domain structure of Optc can be written as:

AA'(13)-BB'(13)-CC'(09)-DD'(15)-EE'(10)-FF'(20)-G

The numbers in parenthesis refer to the residue lengths of the outer intervening segments (A'-F'). The Optc thus has an irregular outer convex surface due to the great variation in length of the intervening segments. A remarkable feature of the Optc model is that the outer segments C' and E' are not long enough to form helices. Indeed they are so short that it is likely that grooves are formed on the outer surface of the molecule at these sites (Figure 4A). The same profile can be written for the close homologue osteoglycin indicating that this protein would have a similar shape. By comparison, the structure of the repeating core region in decorin, which has ten LRR repeats, can be represented as:

AA'(13)-BB'(13)-CC'(10)-DD'(13)-EE'(15)-FF'(10)-GG'(13)-HH'(13)-II'(12)-J

This domain structure is more regular than Optc with five of the nine outer intervening segments comprised of 13 residues of similar sequence to those in opticin. The short outer segments C' and F' of decorin have 10 residues of similar sequence to segment E' of opticin. Thus the outer surfaces of different LRR proteins may require distinctive combinations of grooves or notches as a result of intervening segment variation, thereby defining important functional differences between the proteins.

The model also has some accessible non-polar patches that may have important binding functions. In the model of Optc, the grooves made by the outer segments C' and E' are predominantly non-polar at the base (Figure 4B). Outer segment D', which separates the grooves, is also predominantly hydrophobic. The result is a continuous hydrophobic patch that extends from one groove to the other, with outer segment D' as a bridge between them. The groove is flanked on the C-terminal side by the loop that connects outer segment F' with the final LRR (see Figure 3B), which forms a prominent cationic patch on the surface and which also coincides with the antigenic peptide discussed below. The sole cysteine in this domain occurs on outer segment F' and is oriented towards the surface, suitable for disulphide cross-linking with other cysteines in the molecule.

Immunochemistry

A polyclonal antiserum, OCGp1, was raised against a peptide, CDPEEHKHTRRQ, (residues 289-300) chosen from the predicted sequence. The model indicates that the peptide used to generate the antiserum occupies a highly exposed location on outer segment F' descending from the alpha helix and continuing into the next beta strand (Figure 5A). The exposure of the region is augmented by the fact that it is next to the cleft formed by the short ten-residue outer segment E'. The model predicts that the residues within it form a "cationic patch" on the surface of the molecule. This could be of significance if the protein has any receptor activity for molecules with anionic groups e.g., polynucleotides, or proteins that have anionic carbohydrate attached, for instance, sialic acid. (It also suggests that the antibody might, in future experiments, be of use in confirming this as the site of such interactions, by acting as a binding inhibitor). A good correlation has been seen between strong anti-peptide antibody activity and putative protein antigenic sites, which have been predicted by molecular modeling [10]. The observation that CDPEEHKHTRRQ elicits a strong response is highly consistent with the model of Optc.

The OCGp1 antiserum was tested in western blots of soluble extracts of human (80 year) and rat eye tissues. In human eye tissues, the antiserum recognized a single major band of 48 kDa in iris and ciliary body (Figure 5B). A similar band was also seen in retina, but at least two other smaller bands were also strongly detected. These may represent proteolytically processed forms absent from iris and ciliary body. The predicted size of unmodified Optc is 37 kDa. However, related SLRPs are post-translationally modified with carbohydrate moieties [1], giving an increase in apparent size. Indeed, bovine vitreous Optc has a reported native size of 45 kDa [8] and contains sialyated O-linked oligosaccharides, although it apparently lacks the glycosaminoglycan chains typical of proteoglycans. The 48 kDa band thus probably represents post-translationally modified, secreted Optc.

In rat tissues the results were somewhat different (Figure 5C). A single major band of 37 kDa, the size of unmodified Optc, was detected in trabecular meshwork/iris, vitreous, retina, optic nerve head and brain. A less intense band of approximately 50 kDa was also apparent in vitreous (weakly) and retina. Faint, larger bands were weakly detectable in some other tissues, probably the result of a low level of cross-reactivity with other proteins. These results suggest that there may be species differences in the degree of post-translational modification of Optc, with unmodified forms predominating in rat as compared with human. In the human sample, age may also be a factor in increased modification.

RH mapping

Specific primers from the predicted 3' UTR of the human cDNA were chosen and used to map the position of the OPTC gene using the Stanford G3 RH panel. The results of searching 15,398 markers showed closest linkage (lod score 12.38) to marker SHGC-5791, GDB locus D1S2570. This marker is on the q arm of chromosome 1, equivalent to 1q31 in cytogenic maps. Three diseases of the posterior segment of the eye have been mapped to this region. A dominant locus for age-related macular degeneration (ARMD1) maps to chromosome 1q between markers D1S466 and D1S413 [11]. Retinitis pigmentosa (RP12) also maps to chromosome 1q31-q32.1. For RP12, mutations in the gene CRB1 (a homolog of the Drosophila gene crumbs) have been identified [12]. Posterior column ataxia with retinitis pigmentosa (AXPC1), maps to 1q31-q32, flanked by markers D1S2692 and D1S414 [13]. According to the present mapping, OPTC appears to lie between RP12 and AXPC1.

Conclusions

Optc is a newly recognized LRR protein of the human eye. As judged by its occurrence in the various cDNA libraries represented in dbEST, OPTC seems to be highly eye-preferred in expression, although it has also been detected by PCR in human skin [8] and here by immunochemistry in rat brain. Indeed, at the level of cDNA, OPTC is one of the most abundant transcripts detected in adult human iris. In human eye tissues antiserum raised against a specific peptide detects a protein of approximately 48 kDa in iris, ciliary body, and retina. This distribution agrees with the results of EST analyses. However, while OPTC is much more abundant in iris than in retina at the cDNA level, in western blots Optc protein appears to be more abundant in retina. Retina also contains smaller immunogenic bands that may represent proteolytically processed Optc molecules. Since Optc appears to be a secreted protein, the relatively greater abundance of its immunoreactivity in retina may reflect preferred binding of proteins synthesized in other parts of the eye.

Interestingly, although in adult human and bovine [8] eyes Optc evidently undergoes post-translational modification, in rat this seems to occur at a lower level. The major protein detected by immunochemistry in rat and also in mouse (not shown) is the size of unmodified Optc. This suggests that the addition of carbohydrate moieties documented for the bovine protein [8] may not be essential for all aspects of function.

The function of Optc remains to be determined. Proteins of this superfamily have diverse, important functions that all relate to binding activity. The model of Optc shows the familiar concave surface that in related proteins can bind targets such as extracellular matrix components. The convex surface also shows some interesting patches where the regular LRR structure is modified and which may represent other binding sites. The OCGp1 antiserum may provide a tool for identification of some binding partners through co-immunoprecipitaion.

Many genes with eye-specific or eye-preferred patterns of expression have proved to be the loci for inherited disease [14]. RH mapping of OPTC localizes the gene to the long arm of chromosome 1, in the 1q31 region. At least three genetic diseases of retina are in the same region and for two of these, AXPC1 and ARMD1 no candidate gene is yet characterized.

Acknowledgements

PH and CS thank the Medical Research Council, London for support.

References

1. Iozzo RV. The biology of the small leucine-rich proteoglycans. Functional network of interactive proteins. J Biol Chem 1999; 274:18843-6.

2. Kajava AV, Vassart G, Wodak SJ. Modeling of the three-dimensional structure of proteins with the typical leucine-rich repeats. Structure 1995; 3:867-77.

3. Guex N, Diemand A, Peitsch MC. Protein modelling for all. Trends Biochem Sci 1999; 24:364-7.

4. Cornell WD, Cieplak P, Bayly CL, Gould IR, Merz Jr. KM, Ferguson DM, Spellmeyer DC, Fox T, Caldwell JW, Kollman PA. A second-generation force field for the simulation of proteins, nucleic acids and organic molecules. J Am Chem Soc 1995; 117:5179-97.

5. Lasowski RA, MacArthur AMW, Moss DS, Thornton JM. PROCHECK: a program to check the stereochemical quality of protein structures. J Appl Cryst 1993; 26:283-291.

6. Nicholls A, Sharp KA, Honig B. Protein folding and association: insights from the interfacial and thermodynamic properties of hydrocarbons. Proteins 1991; 11:281-96.

7. Wistow G. Lens crystallins: a model system for gene recruitment. In: Zimmer EA, White TJ, Cann RL, Wilson AC, editors. Methods in enzymology, Vol 224. Molecular evolution: producing the biochemical data. San Diego: Academic Press; 1993. p. 563-75.

8. Reardon AJ, Le Goff M, Briggs MD, McLeod D, Sheehan JK, Thornton DJ, Bishop PN. Identification in vitreous and molecular cloning of opticin, a novel member of the family of leucine-rich repeat proteins of the extracellular matrix. J Biol Chem 2000; 275:2123-9.

9. Kobe B, Deisenhofer J. The leucine-rich repeat: a versatile binding motif. Trends Biochem Sci 1994; 19:415-21.

10. Hobby P, Ward FJ, Denbury AN, Williams DG, Staines NA, Sutton BJ. Molecular modeling of an anti-DNA autoantibody (V-88) and mapping of its V region epitopes recognized by heterologous and autoimmune antibodies. J Immunol 1998; 161:2944-52.

11. Klein ML, Schultz DW, Edwards A, Matise TC, Rust K, Berselli CB, Trzupek K, Weleber RG, Ott J, Wirtz MK, Acott TS. Age-related macular degeneration. Clinical features in a large family and linkage to chromosome 1q. Arch Ophthalmol 1998; 116:1082-8.

12. den Hollander AI, ten Brink JB, de Kok YJ, van Soest S, van den Born LI, van Driel MA, van de Pol DJ, Payne AM, Bhattacharya SS, Kellner U, Hoyng CB, Westerveld A, Brunner HG, Bleeker-Wagemakers EM, Deutman AF, Heckenlively JR, Cremers FP, Bergen AA. Mutations in a human homologue of Drosophila crumbs cause retinitis pigmentosa (RP12). Nat Genet 1999; 23:217-21.

13. Higgins JJ, Morton DH, Loveless JM. Posterior column ataxia with retinitis pigmentosa (AXPC1) maps to chromosome 1q31-q32. Neurology 1999; 52:146-50.

14. Molday RS. Photoreceptor membrane proteins, phototransduction, and retinal degenerative diseases. The Friedenwald Lecture. Invest Ophthalmol Vis Sci 1998; 39:2491-513.

15. Weber IT, Harrison RW, Iozzo RV. Model structure of decorin and implications for collagen fibrillogenesis. J Biol Chem 1996; 271:31767-70.