Molecular Vision 2005; 11:833-845 <http://www.molvis.org/molvis/v11/a99/> Received 04 April 2005 | Accepted 27 September 2005 | Published 30 September 2005

Download Reprint

The interphotoreceptor retinoid-binding protein (IRBP) of the chicken (Gallus gallus domesticus)

Deborah L. Stenkamp,¹ John L. Calderwood,¹ Ellen E. Van Niel,² Lawrence M. Daniels,¹ Federico Gonzalez-Fernandez^2,3
 
 

¹Department of Biological Sciences, University of Idaho, Moscow, ID; Departments of ²Ophthalmology and ³Pathology, University of Virginia School of Medicine, Charlottesville, VA

Correspondence to: Deborah L. Stenkamp, Department of Biological Sciences, University of Idaho, Moscow, ID, 83844-3051; Phone: (208) 885-8963; FAX: (208) 885-7905; email: dstenkam@uidaho.edu
 
Dr. Federico Gonzalez-Fernandez is now at the Ross Eye Institute, State University of New York at Buffalo and the Medical Research Service of the Veterans Affairs Hospital (Buffalo, NY).

Abstract

Purpose: Despite decades of investigation, the function of interphotoreceptor retinoid binding protein (IRBP), the most abundant protein in the interphotoreceptor matrix of vertebrates, remains enigmatic. Roles for IRBP in the visual cycle of rod photoreceptors and in the independent visual cycle of cone photoreceptors have been suggested, yet very little is known of the biology of IRBP in cone-dominant retinas, such as those of diurnal birds. Our aim was to identify and characterize expression of the IRBP of the cone-dominant chicken (Gallus gallus domesticus).

Methods: Chicken IRBP mRNA was identified by PCR cloning. Primary protein structure, genomic organization, and phylogenies were determined through comparative sequence analyses. Expression of IRBP mRNA was characterized by northern analysis and by in situ hybridization on cryosectioned chicken retina. Expression of the IRBP protein was characterized by western blotting and by indirect immunofluorescence on cryosectioned retina and on retinal whole mounts.

Results: The chicken IRBP gene encodes a secreted protein with a predicted 1,252 amino acid length. The gene structure for chicken IRBP resembles that of most other vertebrates, with four homologous, modular repeats and introns within only the fourth module. Each module is more homologous with the corresponding module in other species than it is with the remaining chicken modules. Chicken retinal tissue contains a single IRBP mRNA transcript of approximately 4.8 kb and western analysis of chicken retina shows a single major band of 140 kDa. Chicken IRBP mRNA is expressed exclusively by retinal photoreceptor cells and the intensity of the hybridization signal shows light/dark rhythmicity. The IRBP protein is localized to the interphotoreceptor matrix of the chicken retina and to intracellular regions of photoreceptors, with a spatial distribution indicating an association with cone outer segments.

Conclusions: The high degree of conservation of IRBP's primary structure, genomic organization, and cell-specific expression within the retinas of all vertebrates examined to date, including those with cone-dominant retinas, implies a conserved role for IRBP in photoreceptor function and/or health. Expression of chicken IRBP and its mRNA are functionally regulated. This report provides a necessary first step to explore a specific function for IRBP in the cone visual cycle.

Introduction

The embryonic origin of the vertebrate retina as an involuted vesicle is an evolutionary innovation allowing functional collaboration between the photoreceptors and the retinal pigment epithelium (RPE) [1]. The photoreceptors are separated from the RPE by the subretinal space, which contains a specialized extracellular material referred to as interphotoreceptor matrix (IPM) [2-5]. The IPM, which does not have a homologous biological counterpart in nonvertebrate retinas, mediates key interactions between the photoreceptors and RPE including adhesion, phagocytosis, outer segment stability, nutrient exchange, development, and vitamin A trafficking in the visual cycle [2-5]. In the vertebrates, unlike insects and cephalopods, 11-cis retinal, photoisomerized to its all-trans isomer in photoreceptors, is not reisomerized in the photoreceptors, but transferred to the RPE and possibly the Müller cells for nonphotochemical enzymatic reisomerization. This transcellular trafficking is impressive in view of the hydrophobicity of retinoids, their vulnerability to oxidative and isomeric degradation, and the potential for cellular toxicity given the membranolytic effects of free retinoids [6-9].

Interphotoreceptor retinoid-binding protein (IRBP) is the most abundant soluble protein of the IPM. IRBP is composed of homologous segments termed modules or repeats, each about 300 amino acid residues in length. Teleost IRBP is composed of two modules [10,11], while IRBP in tetrapods is composed of four modules [12]. Recent X-ray crystallographic analysis is consistent with earlier biochemical studies, demonstrating that each of the modules contains a putative ligand-binding domain [13]. IRBP may participate in the visual cycle by solubilizing retinoids within the IPM, targeting the delivery of all-trans retinol to the RPE, by promoting the release of 11-cis retinal from the RPE, and by targeting its delivery back to the outer segments [14-16]. Interestingly, the visual cycle is not disrupted in transgenic mice lacking IRBP [17,18]. However, other genetic knockouts that failed to yield the expected phenotype have eventually led to a deeper understanding of the molecular physiology of the system and of redundant/alternative pathways; retinoid-binding proteins are not exceptions [19-21]. For example, mice carrying a null mutation in cellular retinoic acid-binding protein appear indistinguishable from the wild-type [19,20]. Similarly, the function of IRBP may not be strictly related to transport, but rather to a related function, such as a requirement when the system is stressed or particularly challenged. One such function may be buffering the concentration of free extracellular retinoids; the presence of IRBP actually slows the transfer of all-trans retinol between liposomes and outer segment membranes [22], and reduces the rate of dark adaptation recovery [18]. Another potential function may be in preserving the isomeric and oxidation state of retinol [23]. This protection is at the expense of IRBP itself, as IRBP bound to retinoids is more susceptible to damage by irradiation than is unbound IRBP [24]. Such a role for IRBP and the resultant damage perhaps explains the observed rapid and highly regulated turnover of IRBP in the IPM [25,26].

The existence of IRBP in the avian retina is controversial. In birds, northern blot analysis has failed to identify IRBP mRNA in chicken, duck, or quail retina [27]. Furthermore, ELISA, western blotting [28], and sucrose density gradient studies [29] have not consistently been able to detect IRBP in the chicken retina, although alternative methods have [30-32]. To explain the apparently poorly detectable levels of IRBP in the avian retina, it has been suggested that purpurin, a retinoid-binding protein in the chicken IPM, assumes the function of IRBP in this species [33,34]. Collectively these studies imply significant differences in the structure and even presence of IRBP in the avian visual system.

Interest in chicken IRBP extends beyond resolving the controversy of its existence in avians. The cone-dominant chicken retina is becoming an important experimental system for examination of the visual cycle. The exciting emerging concept is that vertebrate cones employ a parallel visual cycle independent of that used by rods. Early studies showed that cones but not rods regenerate visual pigment in the absence of the RPE [35-37], although this function requires the presence of other retinal cells [38]. Similarly, isolated cultured chick retinal cells can repeatedly respond to light [39] and metabolize retinoids [40] in the absence of RPE. Furthermore, cones but not rods can regenerate visual pigment from exogenously applied 11-cis retinol [41,42]. Components of a complete visual cycle have recently been identified within cone-dominant neural retinas of chickens and ground squirrels [43], and many of these components have been localized to either cone photoreceptors or Müller glia. For example, cone photoreceptors contain an 11-cis retinol dehydrogenase [43] and RPE65 [44], an enzyme required for the formation of 11-cis retinol in the RPE [45]. Müller glia contain cellular retinaldehyde-binding protein (CRALBP) and cellular retinol binding protein (CRBP) [46,47], but carry retinoid ligands in ratios different from those found in the RPE [48]. Cultured chick retinal glia can convert all-trans retinol to 11-cis retinol [49], making it likely that the retinol isomerase found in cone-dominant retinas [43], is localized to Müller glia. These data indicate that cones and Müller cells together contain all the essential components for carrying out a visual cycle distinct from that used by the rods and the RPE.

Could IRBP have a role in the cone visual cycle [43] Although it could be argued that the distance between the rod outer segment tips and the RPE may present only a negligible diffusion barrier to retinoids, the distance between the cone outer segments and Müller cell villi probably represents a significant barrier to the highly hydrophobic retinoids. It is therefore possible that an important function of IRBP is to solubilize and protect retinoids that are trafficking through the IPM between the Müller cells and cone outer segments. In the retinas of birds and most other nonmammalian vertebrates, this may be particularly important as photomechanical movements alter these distances when lighting conditions change [50]. In part to initiate the examination of the role of IRBP in the visual cycle of cones, we here characterize the primary structure and expression patterns of IRBP in the chicken retina. We present compelling evidence that IRBP is a major component of the chicken IPM, and that chicken IRBP is highly conserved compared to other known vertebrate IRBPs. Chicken IRBP shows previously unrecognized temporal and spatial patterns of expression, suggesting that expression is tightly regulated. Furthermore, we provide evidence that the IRBP protein is associated predominantly with cone photoreceptors. Our findings are consistent with the possible involvement of IRBP in retinoid trafficking and protection in visual cycles of cones.

Methods

Animals

All procedures involving animals were carried out in accordance with the ARVO statement on the Use of Animals in Ophthalmic and Vision Research, and were approved by the Animal Care and Use Committee at University of Virginia. White Leghorn chickens, maintained on a 12 h light:12 h dark cycle (lights on at 6:00 AM; fluorescent room lighting), were used for all experiments except for the whole mount immunocytochemical analysis, for which some of the chickens were of an unknown domesticated strain and were maintained on a small farm in Latah Co., Idaho.

Molecular cloning and sequence analysis

Total chicken retinal RNA was extracted with a Teflon-glass homogenizer using the acid phenol method [51]. RNA was reverse transcribed using random hexamers followed by PCR amplification with a primer pair corresponding to conserved regions of the C-terminus (F: GAGCCATATCTCTTGCCAGT and R: TAGAGGTGTTGACGAGGTTC). The resultant amplification product was subcloned and sequenced. Insert DNA from this PCR clone was used to probe a chicken retina cDNA library (provided by Dr. Mary Pierce, State University of New York, Health Science Center, Syracuse, NY). This library had been prepared from retinal mRNA from three-week-old chicks at 11:00 am (one hour short of mid-light). Positive clones were subjected to sequence analysis. The predicted mRNA sequence of chicken IRBP was used to search [52] the chicken genomic sequence (Gallus) for genomic location and sequence information. Amino acid sequence predictions, alignments [53], and phylogenetic analyses [54] were performed by using Biology Workbench (Biology Workbench 3.2).

Northern analysis

Retinal tissue was obtained from adult chickens at mid-light and was frozen in liquid nitrogen. Tissue was homogenized and total RNA was extracted using the RN-easy kit (Qiagen; Valencia, CA). Total RNA was loaded onto a formaldehyde gel, and then transferred to a nylon membrane by downward capillary transfer [55]. Hybridization was carried out at 68 °C, using 4 μg/ml dig-labeled chicken IRBP cRNA. Hybridization was visualized using the CDP-star chemiluminescence detection system, using methods recommended by the manufacturer (Roche; Indianapolis, IN).

Western blotting

Generation of purified recombinant Xenopus IRBP module 4 (X4IRBP) has been described elsewhere [56]. Rabbits were injected once intradermally and once subcutaneously with 125 μg of this protein suspended in 0.5 ml Freund's complete adjuvant. Interphotoreceptor matrix material was obtained from rat and chicken eyes in the following manner. Lenses were removed from enucleated eyes, and then retinas were gently detached. Whole retinas and RPE-eyecups were washed five times with Ringer's saline [57] containing protease inhibitors (1 mM PMSF; 1 mM EDTA, 1.5 g/ml leupeptin, 1.5 g/ml pepstatin A, 3.0 g/ml aprotinin). Proteins were precipitated from the total soluble IPM fraction with 6% trichloroacetic acid and 0.1% deoxycholic acid, were washed with acetone and then with ethanol, and were resuspended in a reducing Laemmli buffer [58]. Protein was electrophoretically separated on a sodium dodecyl sulfate-10% polyacrylamide gel, and then was electrophoretically transferred to nitrocellulose (NitroBind; Micron Separations, Westboro, MA). The blot was rinsed in buffer (150 mM NaCl, 27 mM KCl, 25 mM Tris pH 8.0, 0.005% nonylphenylene-polyethylene glycol and 0.001% Tween 20), and blocked for two hours in the same buffer containing 0.5% bovine serum albumin (Sigma, St. Louis, MO) and 0.03% nonfat dry milk (Bio-Rad, Hercules, CA). Blots were incubated overnight with 1:1000 anti-X4IRBP serum (or preimmune serum) in blocking solution, then rinsed in buffer and incubated for 2 h with [¹²⁵I]-goat anti-rabbit IgG (ICN, Costa Mesa, CA), in blocking solution.

Tissue preparation for histology cryosections

Eye tissue was obtained at the following times: 2 h light, 6.5 h light, 7 h light, 11 h light, 6 h dark, 7 h dark, and 9 h dark. For dissections during the dark phase of the light/dark cycle, night-vision goggles were used under infrared illumination so that no visible light was necessary for the procedure. Chickens were decapitated and eyes enucleated. The globes were bisected along the equator, the anterior halves and the vitreous gel were discarded, and the posterior halves were immersed in fixative (4% paraformaldehyde in phosphate-buffered 5% sucrose) for 30 min at room temperature. The posterior halves were then bisected along the naso-temporal axis, and then fixed an additional 30 min. Following infiltration with a graded sucrose series, eyes were cryoprotected overnight at 4 °C in phosphate-buffered 20% sucrose, then embedded and frozen in a 1:2 solution of OCT embedding medium (Tissue Tek; Torrance, CA) and 20% sucrose, then sections were cut at 3-5 μm [59].

Whole mounts

For some experiments, chicken heads were obtained on ice from a local (Latah County, Idaho) farmer following decapitation (decapitation performed at 2:00 PM, approximately 7 h after local sunrise). Eyes were enucleated, corneas perforated and lenses removed, and eyes were immersed in fixative overnight at 4 °C. The anterior segments were removed with the goal of retaining the entire retina within the posterior segment, and retinas dissected and washed in phosphate-buffered 5% sucrose, then stored in 100% methanol at -20 °C. For other experiments, paraformaldehyde-fixed posterior segments, obtained from chickens sacrificed at mid-light (generously provided by Dr. Andy Fischer of Ohio State University, Columbus, OH), had retinas removed, washed, and stored in 100% methanol at 20 °C.

In situ hybridization

The full-length cDNAs corresponding to the genes for chicken IRBP, chicken rod opsin and chicken red cone opsin were used to prepare digoxigenin (dig)- or fluorescein (fl)-labeled cRNA probes for nonisotopic in situ hybridization, using components of the Genius kit (Roche). The chicken opsin cDNAs were the generous gifts of Ruben Adler (Johns Hopkins School of Medicine, Baltimore, MD). In situ hybridization methods for cryosections have been described [60-63]. In brief, tissue was rehydrated, digested with 10 μg/ml proteinase K, then treated with triethanolamine-buffered 0.25% acetic anhydride, then tissue was hybridized overnight with 4 mg/ml cRNA probe in a 50% formamide hybridization solution. Tissue was treated with RNAse A, incubated overnight with 1:2000 anti-dig Fab fragments conjugated to alkaline phosphatase (Roche), then hybridization was visualized with 4-nitroblue tetrazolium chloride and 5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP; Roche).

The nonisotopic procedure for the simultaneous detection of two mRNAs in the same cell (or same tissue) has been described [61-64]. Hybridization on cryosections was carried out as above, but two different cRNA probes were in the hybridization solution: a dig-labeled probe and a fl-labeled probe. The dig-labeled probe was visualized by treatment with an anti-dig antibody conjugated to alkaline phosphatase, followed by the Fast Red (Roche) color reaction. Tissue was treated with 1 N HCl and post-fixed in 4% paraformaldehyde, then the fl-labeled probe was visualized by treatment with an anti-fl antibody conjugated to alkaline phosphatase, followed by the NBT/BCIP color reaction.

Immunocytochemistry

Rabbit polyclonal antibody directed at the fourth module of Xenopus IRBP (X4IRBP, 1:500; same antibody as used for western blotting), and mouse monoclonal anti-bovine IRBP (1:500; the gift of Jack Saari, University of Washington, Seattle, WA) [32] were the primary antibodies used for immunocytochemical experiments. Sections were blocked in 20% goat serum and were then incubated overnight at 4 °C in primary antibody. Sections were washed in phosphate-buffered (pH 7.4) saline containing 0.05% Triton X-100 (PBST), incubated for 1-2 h with secondary antibody conjugated to either FITC or Cy3 (Jackson Immunoresearch, Westgrove, PA), washed in PBST, and then were mounted in glycerol containing carbonate-buffered (pH 9.0) 0.4 mg/ml phenylenediamine to preserve fluorescence. Whole mounts were incubated with primary antibody overnight, washed in PBST, incubated in secondary antibody overnight, then mounted, photoreceptor side up, with phenylenediamine, as above.

Photography and image analysis

Images were obtained using a Leica DMR microscope and a Spot camera (Diagnostic Instruments; Sterling Heights, MI) under fluorescence and/or Nomarski optics. Images obtained using several different optical systems were combined using the "apply image" function in Adobe Photoshop software (Adobe Systems; Mountain View, CA).

After immunocytochemistry, whole chicken retinas were mounted on slides backed with 1 mm acetate grids. Defined locations (defined by location on grid) were photographed using a 0.25 s exposure time, and images were scored for brightness of fluorescence by three naïve observers.

Results

Nucleotide and translated amino acid sequences of chicken IRBP

The nucleotide and translated amino acid sequences of chicken IRBP are shown in Figure 1. The size of the mRNA from the ATG start codon to the termination codon is 3,756 nucleotides in length, predicting a protein of 1,252 amino acids. The protein consists of four modules, each about 300 amino acid residues in length; sequence identities among these modules range from 27-33%. The N-terminal 21 amino acid sequence is typical of signal peptides [65], and indicates that this protein is inserted into the endoplasmic reticulum and potentially secreted. Five consensus N-linked glycosylation sites are present, two in the first module and one in each of the remaining modules. The second site in the first module (NTT) and the site in the second module (NHT) are conserved among human, bovine and Xenopus IRBP. The positions of the remaining three glycosylation sites are unique to the chicken sequence. Two highly conserved tryptophan residues per module correspond to the positions of putative ligand binding regions identified by structural analysis of Xenopus module 2 [13].

The chicken IRBP mRNA sequence maps to chromosome 6 of the chicken genome, in a region not previously identified as having an open reading frame. Comparison to the genomic sequence predicts the presence of three introns interrupting the sequence encoding the fourth module (Figure 2A). These exon boundaries are equivalent to those identified in the fourth module of the bovine and human IRBP genes [12,66] and in the second module of the two-module zebrafish IRBP gene [11], suggesting a high degree of conservation of genomic organization. However, the chicken IRBP introns are comparatively large, with the first intron having a length of 6.4 kb, the second 2.7 kb, and the third 2.3 kb.

A nucleotide and predicted amino acid sequence for Gallus gallus IRBP mRNA has been previously reported (GenBank accession number XM426513), and was obtained by using an inbred line of chickens derived from a wild population of Malaysian red jungle fowl in the 1930s. The sequence reported here is 98% identical to this jungle fowl sequence at the amino acid and at the nucleotide level. Interestingly, the inbred jungle fowl mRNA has an additional, in-frame, 246 bp sequence, encoding 82 amino acids, within the fourth exon; this peptide is not present in the domestic chicken protein (Figure 1). This finding does not represent a loss of genetic material in the domesticated chicken, as these 82 amino acids are also not found in the corresponding regions of the human, bovine, or Xenopus IRBP. The 246 bp insert in the jungle fowl IRBP gene appears to be a duplication of a similar sequence located in the second intron. All remaining analyses in this paper used the domesticated chicken IRBP sequence reported here (Figure 1).

The complete protein sequence of chicken IRBP is 63% identical to that of Xenopus IRBP, 64% identical to that of bovine IRBP, and 65% identical to human IRBP. Each module of chicken IRBP shows 9-13% amino acid identity to the C-terminal processing proteases of plants and prokaryotes, as previously shown for other vertebrate IRBPs [56]. In addition, each module of chicken IRBP shows greatest sequence identity to the corresponding modules of Xenopus, human, and bovine IRBPs (Figure 2B). The first module of chicken IRBP corresponds to the first module of zebrafish IRBP, and the fourth module of chicken IRBP corresponds to the second module of zebrafish IRBP. The zebrafish IRBP protein consists of only two modules, teleost fish likely having lost the middle two modules [10,11,67]. These results indicate that the primary structure of IRBP and its component modules have been highly conserved in vertebrates.

Northern and western analysis of chicken IRBP

Northern hybridization of total RNA from chicken retina revealed a predominant single IRBP transcript, of approximately 4.8 kb (Figure 3). No additional transcripts were detected with longer exposure times. This size is consistent with a 3.7 kb coding region (based on sequence analysis) and an approximately 0.5 kb 3'UTR. The anti-X4IRBP serum recognized an abundant 140 kDa protein in the soluble extract of chicken IPM and a 144 kDa protein in the soluble extract of rat IPM. The sizes of chicken and rat IRBPs compare favorably with those analyzed in previous reports (chicken: 138 kDa [30,31]; rat: 144 kDa [30]). Chicken and mammalian IRBPs are slightly larger than the Xenopus IRBP (124 kDa [68]), and approximately twice the size of zebrafish IRBP (66.3 kDa [11]).

Expression pattern of chicken IRBP mRNA: cell-specificity and light/dark rhythmicity

In situ hybridization of a chicken IRBP cRNA revealed expression of IRBP mRNA in retinal photoreceptors, but in no other retinal cell type (Figure 4). Tissue obtained during the dark phase of the light/dark cycle showed very little IRBP mRNA (data not shown), while that obtained during the light phase showed increasingly stronger hybridization signals (Figure 4A,D). The IRBP mRNA expression pattern observed during mid-light (Figure 4D), appeared to involve separate photoreceptor cell populations, and so we compared this pattern to those of rod opsin (Figure 4B,E) and red cone opsin (Figure 4C,F). Early in the light period, IRBP mRNA is predominantly expressed at a retinal depth that also shows weak expression of red cone opsin (Figure 4A,C), while later in the light period, IRBP mRNA is expressed more strongly in this layer, and additionally by a distinctly-localized population of photoreceptors (Figure 4D). This latter photoreceptor population is distributed in spatial pattern similar to that of rods (Figure 4E). Therefore, we interpret these patterns as indicating expression of IRBP mRNA by cones early in the light period, and by both rods and cones later in the light period. Co-localization of rod opsin and IRBP mRNAs to the same cell type (rods) was confirmed by double in situ hybridization (Figure 4G). Interestingly, the different mRNAs do not share the same subcellular localization, with IRBP mRNA in a more apical position relative to the perinuclear localization of rod opsin mRNA. Similar double in situs, using one of the cone opsin cRNAs along with the IRBP probe, were also attempted (data not shown), but were difficult to interpret, possibly because of similar differences in subcellular localization of the different transcripts.

Expression of chicken IRBP: spatiotemporal patterns

Although expression of chicken IRBP mRNA during the dark phase of the light/dark cycle was weak to undetectable, immunocytochemical analysis revealed that IRBP protein is present in the interphotoreceptor matrix at all times examined (Figure 5 and data not shown). Two anti-IRBP antibodies were applied to chicken retinal cryosections: the rabbit polyclonal anti-X4IRBP serum (same as used for the western blot), and a mouse monoclonal anti-bovine IRBP. Photoreceptor outer segments were strongly labeled by the monoclonal antibody, while the polyclonal antibody showed preferential staining of inner segments. This staining of inner segments had a granular appearance, perhaps representing discrete localization of IRBP in internal vesicles. The inner segment staining by the polyclonal antibody became negligible when detergent was omitted from the immunocytochemistry procedure, (data not shown), further suggesting that this antibody recognizes an intracellular form of chicken IRBP.

The labeling intensity of the immunoreactions was not the same in all retinal regions (not shown). To further characterize potential regional differences, we examined the topography of staining intensity in retinal whole mounts, using the monoclonal anti-bovine IRBP antibody. In these preparations, immunospecific fluorescence shows a typical interphotoreceptor matrix pattern, outlining individual photoreceptor cells (Figure 6). We used these preparations to compare the fluorescence seen in different topographical regions of the retina. The temporal-ventral retinal regions had slightly higher levels of IRBP immunofluorescence than nasal, dorsal, and especially central regions. These regions with brightest immunofluorescence also showed a higher proportion of the smallest cell profiles, and these profiles showed the most intense fluorescence (Figure 6). Initially we assumed that these profiles corresponded to rod outer segments; however, rod and cone outer segments in the chick retina have similar diameters [69]. Therefore we performed double labeling experiments using the cone-specific peanut lectin [70]. This experiment revealed that the small, IRBP-positive cell profiles do not correspond to rod outer segments, but instead are cone outer segments, as they were all peanut lectin-positive (Figure 6E-G). In these double-labeled whole mount preparations, we could not identify any IRBP-positive profiles that were not also peanut lectin-positive, suggesting that IRBP may not be associated with rod outer segments in the chicken retina. The reciprocal experiment of combining the IRBP antibody with a rod-specific marker was not possible as the most reliable rod marker (Rho4D2) also labels green-sensitive cones in the chicken, and is a mouse monoclonal antibody [71], making this double labeling experiment unfeasible. Interestingly, some peanut lectin-positive profiles were not IRBP-positive, suggesting that a subpopulation of cones may not have IRBP present in the surrounding interphotoreceptor matrix.

Discussion

The chicken interphotoreceptor matrix contains a glycosylated protein homologous to the IRBPs of other vertebrates. This protein has similar size and immunogenic properties as bovine and Xenopus IRBPs [30,68], and is approximately twice the size of the IRBPs of teleost fish [10,11]. Chicken IRBP has a modular structure similar to that of other vertebrates, with slight primary structure similarity to C-terminal processing proteases [56] and contains the conserved tryptophan residues that may correspond to a ligand-binding region [13]. Chromosome 6 of the chicken genome contains an IRBP gene not dissimilar from that of other vertebrates, with three introns in the region encoding the fourth module [11,12,66]. The introns of the chicken IRBP gene are substantially longer than those of other vertebrates, but the exon boundaries have been conserved. The mRNA is approximately the same size (4.8 kb) as the mRNAs encoding monkey, human, and guinea pig IRBPs (4.6 kb, 4.6 kb, 4.9 kb, respectively [27]).

Chicken IRBP may not have been consistently detected by others previously [28,29] because of differences in protein glycosylation that contribute to different antigenic and biochemical properties. Most previous work done to identify IRBP in chicken retina and IPM has made use of antibodies, either via ELISA [28], western blot [28,30], or immunocytochemistry [32]. Studies making use of a monoclonal or polyclonal anti-bovine IRBP antibodies [30,32] (including the present study), successfully detected IRBP in the chicken retina, while those using a polyclonal anti-monkey IRBP did not [28]. The antigenic sites for these antibodies have not been determined. However, chicken IRBP does contain three glycosylation sites that are unique to the chicken protein that may mask epitopes conserved in other IRBPs. Differences in glycosylation may also contribute to distinctive biochemical behavior of chicken IRBP in sucrose density centrifugation experiments [29]. In addition, nucleotide sequence comparisons may offer an explanation for the lack of positive identification of chicken IRBP mRNA by Northern analysis [27]. The bovine IRBP cDNA probe used in the previous experiments spans the first and second exons; this region shows approximately 49% identity (between chicken and bovine) at the nucleic acid level, as compared to 64% identity when the entire mRNA sequence is considered.

Chicken IRBP is synthesized and secreted by retinal photoreceptor cells, and is associated with photoreceptor outer segments. No other cell type within the retina showed IRBP labeling by either in situ hybridization or immunofluorescence. Furthermore, IRBP mRNA was clearly present within both rod and cone photoreceptors and the IRBP protein was associated with outer segment profiles of varying diameter. This cellular expression pattern is consistent with that of virtually all vertebrates examined [68,72], with the exception of zebrafish, which also show expression of IRBP within the RPE [62]. However, our analysis may not have detected IRBP mRNA within the RPE, since melanin granules may have obscured any hybridization color reaction.

Interestingly, IRBP mRNA had a rather distinct subcellular localization within rod photoreceptors, apical to the subcellular distribution of rod opsin mRNA. This observation suggests that rods may contain distinct protein synthesis domains, specialized for the production of specific proteins that rods must generate in abundance. Alternatively, the observed differences in subcellular distribution of specific mRNAs may reflect a difference in peak transcription time for each transcript, combined with intracellular vectorial processing of the mRNAs generated. Either interpretation would indicate that IRBP expression is subject to a high degree of regulation.

Expression of IRBP mRNA displayed some light/dark rhythmicity. The weakest hybridization was observed in tissue obtained during the dark phase of the light/dark cycle, while stronger hybridization was observed in tissue obtained during mid-light. Although we have no quantitative data to confirm these observations, they are consistent with the circadian patterns of IRBP expression described for other vertebrates [11,26]. It will be interesting to determine whether these changes are regulated by the light/dark cycle or by an endogenous circadian rhythm, as demonstrated for zebrafish IRBP [11]. Part of the rhythmicity of IRBP mRNA expression involved distinct photoreceptor populations: Rods appeared to contain IRBP mRNA only during the light phase of the light/dark cycle, with peak hybridization occurring at mid-light. This finding suggests that rod and cone IRBP expression may be regulated independently. In the zebrafish, different photoreceptor populations also independently regulate IRBP expression, but in this teleost species all photoreceptors, including rods, express IRBP mRNA during the subjective light period, while only ultraviolet-sensitive cones express IRBP mRNA during the subjective dark period [11]. The expression pattern of chicken IRBP mRNA during the dark period suggests that it is not confined to violet-sensitive cone photoreceptors, since violet cones are distributed much more sparsely than is IRBP expression (not shown).

An unexpected finding was the differential intracellular expression of IRBP at mid-light compared to that at mid-dark as revealed by the polyclonal and monoclonal antibodies. The polyclonal antibody showed a typical staining pattern characteristic of a protein largely sequestered within the interphotoreceptor matrix [32]. The monoclonal antibody showed a different pattern. Instead of outlining the outer segments, the staining was in a granular pattern associated with the inner segments. A granular pattern of intracellular IRBP staining has also been observed in mouse retinal photoreceptors (Dr. John C. Saari, personal communication). This cytoplasmic staining pattern may represent an inaccessible epitope that is unavailable in the fully processed, secreted protein. If this interpretation is correct, then the more robust labeling by the polyclonal antibody seen at mid-light (Figure 5A) may indicate a higher rate of IRBP synthesis at this time. Together with the mRNA expression results described above, strongly suggest circadian or light-regulated IRBP production. Alternatively, the intracellular staining may represent IRBP uptake by the photoreceptors [73]. Uptake and degradation of IRBP could unmask an epitope recognized by the monoclonal antibody. This would be consistent with an increased rate of IRBP turnover during the day [26] and with a role for intracellular uptake of IRBP in retinoid trafficking. In any event, these observations suggest an additional level of regulatory complexity that has not been previously recognized, and may provide clues as to the function of IRBP.

In contrast to the light-dark rhythms observed for IRBP mRNA, and for intracellular IRBP, the extracellular IRBP associated with outer segments showed little temporal variability in immunofluorescence. The only variability in IRBP immunofluorescence detected was spatial, rather than temporal, and since this was visible on sectioned material (not shown) and on whole mounts, we believe that any temporal variability would have been similarly noted. In zebrafish, the rate of IRBP degradation is highest during times that IRBP synthesis is highest; this apparent matching of protein turnover to protein production may allow for IRBP levels to remain constant in the interphotoreceptor matrix [26]. A similar situation may take place in the chicken retina, such that IRBP degradation may also peak at mid-light, to maintain consistent levels of extracellular IRBP.

Extracellular IRBP showed the most intense immunofluorescence in temporal-ventral regions of the adult chicken retina and the most intense immunofluorescence surrounded the smallest outer segment profiles. These data suggest that IRBP may be preferentially associated with specific photoreceptor type(s). In the embryonic chick retina, rod opsin expression also shows a similar topographic pattern: few or no rods in the area centralis, slightly more abundant rods in dorsal retina, and highest density of rods in ventral retina [74]. However, this similarity does not reflect an association of IRBP with rods, as all IRBP-positive cell profiles were also peanut lectin-positive. Collectively, these results are consistent with the IRBP protein having an association with the majority of cone photoreceptors, but perhaps not with rod photoreceptors. This finding is puzzling given that rods clearly participate in the synthesis of IRBP, based upon the in situ hybridization studies presented here. It is possible that the quantity of IRBP protein associated with rods may be too low for detection, or that tissue obtained at alternative times of the light/dark cycle might reveal different labeling patterns. Therefore, while these findings support a role for IRBP in the cone visual cycle, further studies and additional cell-specific markers will be needed to more clearly identify the photoreceptor cell type(s) that are associated, and those that are not associated, with IRBP in the chicken retina.

Conclusions: principles of IRBP conservation and functional implications

The genomic organization of the IRBP gene and the primary structure of the IRBP protein are conserved across vertebrate phyla. This supports the contention that IRBP is likely present in all vertebrates, regardless of whether the animal is rod- or cone-dominant, and regardless of phylogenetic history. Specific amino acid residues within IRBP, including several tryptophan residues corresponding to putative ligand-binding regions [13], are conserved 100% across all vertebrates examined. This argues strongly for an important function for IRBP in vertebrate vision and for a function that involves the binding of a hydrophobic ligand [75].

The expression pattern of IRBP mRNA is also highly conserved, as it is photoreceptor-specific in all vertebrates with the exception of the zebrafish [62], but not restricted to any photoreceptor type [72,76,77]. Changes in IRBP mRNA and/or protein expression as a function of the light-dark cycle [11,26,78] and the presence of subcellular domains for IRBP production and/or uptake, indicate that IRBP production is tightly regulated. This again argues for an important role for IRBP in photoreceptor function or photoreceptor health. Although rod-dominant mice that lack IRBP retain basic photoreceptor function and a normal visual cycle, they also show a photoreceptor degeneration [17,18]. The primary function of IRBP remains enigmatic, but could be related to photoreceptor survival or to the distinct visual cycle of cone photoreceptors [43].

To our knowledge, this is the first extensive report of IRBP in a cone-dominant retina, beyond the in situ hybridization studies of Porrello et al. [72] in the ground squirrel retina. We pursued chicken IRBP in part because of a predicted role for IRBP in the cone visual cycle [43]. We find that IRBP is indeed present and potentially tightly regulated in the chicken retina, but that many of the features of IRBP examined are not greatly different from those seen in other, rod-dominant vertebrates. However, it is notable that in the chicken retina, cone photoreceptors appear to be doing the bulk of IRBP synthesis and extracellular IRBP appears to be associated more with cone outer segments than with rod outer segments. If IRBP is important for the visual cycle, our results, together with previous work on this protein, suggest potential activities in the cone visual cycle. The chicken retina now offers the opportunity to explore roles forIRBP in cone photoreceptor function and survival.

Acknowledgements

The authors wish to acknowledge Dr. Mary Pierce (SUNY, Syracuse, NY) for providing the chick retinal cDNA library, Dr. Jack Saari (University of Washington, Seattle, WA) for providing the antibovine IRBP monoclonal and for critically assessing the manuscript, Dr. Ruben Adler (Johns Hopkins University, Baltimore, MD) for providing chicken opsin cDNAs, Dr. Andy Fischer (Ohio State University, Columbus, OH) for providing chicken eye tissues, Dr. Celeste Brown (University of Idaho, Moscow, ID) for assistance with the phylogenetic analysis, Dr. Jacques Retief, and Dr. Edward Oliver (University of Virginia, Charlottesville, VA) for their help in characterizing the chicken IRBP gene during the early phases of this work; Dr. Yongde Bao (University of Virginia, Charlottesville, VA) for confirming the sequence of the expression plasmids by DNA sequencing, and Ms. Ruth Frey, Mr. Brian Withers, and Ms. Sheri Wardwell (Universtiy of Idaho) for technical assistance. Our study was supported by National Institutes of Health grants EY09412 (FG-F) and EY012146 (DLS), the Thomas F. Jeffress and Kate Miller Memorial Trust, and an unrestricted grant from Research to Prevent Blindness. Dr. Gonzalez-Fernandez is currently the "Ira G. Ross and Elizabeth Pierce Olmsted Ross, MD" Chair of Ophthalmic Pathology at SUNY Buffalo.

References

1. Fernald RD. Evolution of eyes. Curr Opin Neurobiol 2000; 10:444-50.

2. Hageman GS, Johnson LV. Structure, composition and function of the retinal interphotoreceptor matrix. In: Osborne NN, Chader GJ, editors. Progress in retinal research. Vol. 10. Oxford: Pergamon Press; 1990. p. 207-49.

3. Mieziewska K. The interphotoreceptor matrix, a space in sight. Microsc Res Tech 1996; 35:463-71.

4. Hageman GS, Kuehn MH. Biology of the interphotoreceptor matrix-retinal interface. In: Marmor MF, Wolfensberber TJ, editors. The retinal pigment epithelium: function and disease. New York: Oxford University Press; 1998. p. 417-54.

5. Hollyfield JG. Hyaluronan and the functional organization of the interphotoreceptor matrix. Invest Ophthalmol Vis Sci 1999; 40:2767-9.

6. Delmelle M. Retinal sensitized photodynamic damage to liposomes. Photochem Photobiol 1978; 28:357-60.

7. Pogozheva ID, Fedorovich IB, Ostrovskii MA, Emanuel' NM. [Photodamage of rhodopsin molecule. Oxidation of SH-group]. Biofizika 1981; 26:398-403.

8. Ostrovskii MA, Fedorovich IB. [Retinal as a photo-damage sensitizer of retinal-containing retina proteins]. Biofizika 1994; 39:13-25.

9. Sun H, Nathans J. ABCR, the ATP-binding cassette transporter responsible for Stargardt macular dystrophy, is an efficient target of all-trans-retinal-mediated photooxidative damage in vitro. Implications for retinal disease. J Biol Chem 2001; 276:11766-74.

10. Wagenhorst BB, Rajendran RR, Van Niel EE, Hessler RB, Bukelman A, Gonzalez-Fernandez F. Goldfish cones secrete a two-repeat interphotoreceptor retinoid-binding protein. J Mol Evol 1995; 41:646-56.

11. Rajendran RR, Van Niel EE, Stenkamp DL, Cunningham LL, Raymond PA, Gonzalez-Fernandez F. Zebrafish interphotoreceptor retinoid-binding protein: differential circadian expression among cone subtypes. J Exp Biol 1996; 199:2775-87.

12. Borst DE, Redmond TM, Elser JE, Gonda MA, Wiggert B, Chader GJ, Nickerson JM. Interphotoreceptor retinoid-binding protein. Gene characterization, protein repeat structure, and its evolution. J Biol Chem 1989; 264:1115-23.

13. Loew A, Gonzalez-Fernandez F. Crystal structure of the functional unit of interphotoreceptor retinoid binding protein. Structure (Camb) 2002; 10:43-9.

14. Pepperberg DR, Okajima TL, Wiggert B, Ripps H, Crouch RK, Chader GJ. Interphotoreceptor retinoid-binding protein (IRBP). Molecular biology and physiological role in the visual cycle of rhodopsin. Mol Neurobiol 1993; 7:61-85.

15. Saari JC. Retinoids in photosensitive systems. In: Sporn MB, Roberts AB, Goodman DS, editors. The retinoids: biology, chemistry, and medicine. New York: Raven Press; 1994. p. 351-85.

16. McBee JK, Palczewski K, Baehr W, Pepperberg DR. Confronting complexity: the interlink of phototransduction and retinoid metabolism in the vertebrate retina. Prog Retin Eye Res 2001; 20:469-529.

17. Palczewski K, Van Hooser JP, Garwin GG, Chen J, Liou GI, Saari JC. Kinetics of visual pigment regeneration in excised mouse eyes and in mice with a targeted disruption of the gene encoding interphotoreceptor retinoid-binding protein or arrestin. Biochemistry 1999; 38:12012-9.

18. Ripps H, Peachey NS, Xu X, Nozell SE, Smith SB, Liou GI. The rhodopsin cycle is preserved in IRBP "knockout" mice despite abnormalities in retinal structure and function. Vis Neurosci 2000; 17:97-105.

19. Gorry P, Lufkin T, Dierich A, Rochette-Egly C, Decimo D, Dolle P, Mark M, Durand B, Chambon P. The cellular retinoic acid binding protein I is dispensable. Proc Natl Acad Sci U S A 1994; 91:9032-6.

20. Lampron C, Rochette-Egly C, Gorry P, Dolle P, Mark M, Lufkin T, LeMeur M, Chambon P. Mice deficient in cellular retinoic acid binding protein II (CRABPII) or in both CRABPI and CRABPII are essentially normal. Development 1995; 121:539-48.

21. Gottesman ME, Quadro L, Blaner WS. Studies of vitamin A metabolism in mouse model systems. Bioessays 2001; 23:409-19.

22. Ho MT, Massey JB, Pownall HJ, Anderson RE, Hollyfield JG. Mechanism of vitamin A movement between rod outer segments, interphotoreceptor retinoid-binding protein, and liposomes. J Biol Chem 1989; 264:928-35.

23. Crouch RK, Hazard ES, Lind T, Wiggert B, Chader G, Corson DW. Interphotoreceptor retinoid-binding protein and alpha-tocopherol preserve the isomeric and oxidation state of retinol. Photochem Photobiol 1992; 56:251-5.

24. Fedorovich IB, Semenova EM, Grant K, Converse CA, Ostrovsky MA. Photosensitized light-induced damage of IRBP (interphotoreceptor retinoid-binding protein): effects on binding properties. Curr Eye Res 2000; 21:975-80.

25. Cunningham LL, Yang L, Gonzalez-fernandez F. Interphotoreceptor retinoid-binding protein (IRBP) is rapidly cleared from the Xenopus interphotoreceptor matrix. Exp Eye Res 1999; 68:399-410.

26. Cunningham LL, Gonzalez-Fernandez F. Coordination between production and turnover of interphotoreceptor retinoid-binding protein in zebrafish. Invest Ophthalmol Vis Sci 2000; 41:3590-9.

27. Inouye LN, Albini A, Chader GJ, Redmond TM, Nickerson JM. mRNA for interphotoreceptor retinoid-binding protein (IRBP): distribution and size diversity in vertebrate species. Exp Eye Res 1989; 49:171-80.

28. Wiggert B, Lee L, Rodrigues M, Hess H, Redmond TM, Chader GJ. Immunochemical distribution of interphotoreceptor retinoid-binding protein in selected species. Invest Ophthalmol Vis Sci 1986; 27:1041-9.

29. Wiggert B, Bergsma DR, Lewis M, Chader GJ. Vitamin A receptors: retinol binding in neural retina and pigment epithelium. J Neurochem 1977; 29:947-54.

30. Bridges CD, Liou GI, Alvarez RA, Landers RA, Landry AM Jr, Fong SL. Distribution of interstitial retinol-binding protein (IRBP) in the vertebrates. J Exp Zool 1986; 239:335-46.

31. Bridges CD, Alvarez RA, Fong SL, Liou GI, Ulshafer RJ. Rhodopsin, vitamin A, and interstitial retinol-binding protein in the rd chicken. Invest Ophthalmol Vis Sci 1987; 28:613-7. Erratum in: Invest Ophthalmol Vis Sci 1987; 28:920.

32. Fischer AJ, Wallman J, Mertz JR, Stell WK. Localization of retinoid binding proteins, retinoid receptors, and retinaldehyde dehydrogenase in the chick eye. J Neurocytol 1999; 28:597-609.

33. Schubert D, LaCorbiere M, Esch F. A chick neural retina adhesion and survival molecule is a retinol-binding protein. J Cell Biol 1986; 102:2295-301.

34. Berman P, Gray P, Chen E, Keyser K, Ehrlich D, Karten H, LaCorbiere M, Esch F, Schubert D. Sequence analysis, cellular localization, and expression of a neuroretina adhesion and cell survival molecule. Cell 1987; 51:135-42.

35. Goldstein EB. Visual pigments and the early receptor potential of the isolated frog retina. Vision Res 1968; 8:953-63.

36. Goldstein EB. Cone pigment regeneration in the isolated frog retina. Vision Res 1970; 10:1065-8.

37. Goldstein EB, Wolf BM. Regeneration of the green-rod pigment in the isolated frog retina. Vision Res 1973; 13:527-34.

38. Liebman PA, Entine G. Sensitive low-light-level microspectrophotometer: detection of photosensitive pigments of retinal cones. J Opt Soc Am 1964; 54:1451-9.

39. Stenkamp DL, Adler R. Photoreceptor differentiation of isolated retinal precursor cells includes the capacity for photomechanical responses. Proc Natl Acad Sci U S A 1993; 90:1982-6.

40. Stenkamp DL, Adler R. Cell-type- and developmental-stage-specific metabolism and storage of retinoids by embryonic chick retinal cells in culture. Exp Eye Res 1994; 58:675-87.

41. Jones GJ, Fein A, MacNichol EF Jr, Cornwall MC. Visual pigment bleaching in isolated salamander retinal cones. Microspectrophotometry and light adaptation. J Gen Physiol 1993; 102:483-502.

42. Jin J, Jones GJ, Cornwall MC. Movement of retinal along cone and rod photoreceptors. Vis Neurosci 1994; 11:389-99. Erratum in: Vis Neurosci 1994; 11:838.

43. Mata NL, Radu RA, Clemmons RC, Travis GH. Isomerization and oxidation of vitamin a in cone-dominant retinas: a novel pathway for visual-pigment regeneration in daylight. Neuron 2002; 36:69-80.

44. Znoiko SL, Crouch RK, Moiseyev G, Ma JX. Identification of the RPE65 protein in mammalian cone photoreceptors. Invest Ophthalmol Vis Sci 2002; 43:1604-9.

45. Redmond TM, Yu S, Lee E, Bok D, Hamasaki D, Chen N, Goletz P, Ma JX, Crouch RK, Pfeifer K. Rpe65 is necessary for production of 11-cis-vitamin A in the retinal visual cycle. Nat Genet 1998; 20:344-51.

46. Bunt-Milam AH, Saari JC. Immunocytochemical localization of two retinoid-binding proteins in vertebrate retina. J Cell Biol 1983; 97:703-12.

47. Saari JC, Bunt-Milam AH, Bredberg DL, Garwin GG. Properties and immunocytochemical localization of three retinoid-binding proteins from bovine retina. Vision Res 1984; 24:1595-603.

48. Saari JC, Bredberg L, Garwin GG. Identification of the endogenous retinoids associated with three cellular retinoid-binding proteins from bovine retina and retinal pigment epithelium. J Biol Chem 1982; 257:13329-33.

49. Das SR, Bhardwaj N, Kjeldbye H, Gouras P. Muller cells of chicken retina synthesize 11-cis-retinol. Biochem J 1992; 285:907-13.

50. Burnside B. Light and circadian regulation of retinomotor movement. Prog Brain Res 2001; 131:477-85.

51. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 1987; 162:156-9.

52. Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 1997; 25:3389-402.

53. Thompson JD, Higgins DG, Gibson TJ. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 1994; 22:4673-80.

54. Saitou N, Nei M. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 1987; 4:406-25.

55. Sambrook J, Russell DW. Molecular cloning: a laboratory manual, 3rd ed. Cold Spring Harbor (NY): Cold Spring Harbor Laboratory Press; 2001.

56. Baer CA, Van Niel EE, Cronk JW, Kinter MT, Sherman NE, Braiman MS, Gonzalez-Fernandez F. Arginine to glutamine substitutions in the fourth module of Xenopus interphotoreceptor retinoid-binding protein. Mol Vis 1998; 4:30 <http://www.molvis.org/molvis/v4/a30/>.

57. Basinger SF, Hall MO. Rhodopsin biosynthesis in vitro. Biochemistry 1973; 12:1996-2003.

58. Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970; 227:680-5.

59. Barthel LK, Raymond PA. Improved method for obtaining 3-microns cryosections for immunocytochemistry. J Histochem Cytochem 1990; 38:1383-8.

60. Barthel LK, Raymond PA. Subcellular localization of alpha-tubulin and opsin mRNA in the goldfish retina using digoxigenin-labeled cRNA probes detected by alkaline phosphatase and HRP histochemistry. J Neurosci Methods 1993; 50:145-52.

61. Stenkamp DL, Barthel LK, Raymond PA. Spatiotemporal coordination of rod and cone photoreceptor differentiation in goldfish retina. J Comp Neurol 1997; 382:272-84.

62. Stenkamp DL, Cunningham LL, Raymond PA, Gonzalez-Fernandez F. Novel expression pattern of interphotoreceptor retinoid-binding protein (IRBP) in the adult and developing zebrafish retina and RPE. Mol Vis 1998; 4:26 <http://www.molvis.org/molvis/v4/a26/>.

63. Stenkamp DL, Powers MK, Carney LH, Cameron DA. Evidence for two distinct mechanisms of neurogenesis and cellular pattern formation in regenerated goldfish retinas. J Comp Neurol 2001; 431:363-81.

64. Hauptmann G, Gerster T. Two-color whole-mount in situ hybridization to vertebrate and Drosophila embryos. Trends Genet 1994; 10:266.

65. von Heijne G. Signal sequences. The limits of variation. J Mol Biol 1985; 184:99-105.

66. Liou GI, Ma DP, Yang YW, Geng L, Zhu C, Baehr W. Human interstitial retinoid-binding protein. Gene structure and primary structure. J Biol Chem 1989; 264:8200-6.

67. Nickerson JM, Chin HS, Ciavatta VT. Evolution of the IRBP gene. ARVO Annual Meeting; 2005 May 1-5; Fort Lauderdale (FL).

68. Gonzalez-Fernandez F, Kittredge KL, Rayborn ME, Hollyfield JG, Landers RA, Saha M, Grainger RM. Interphotoreceptor retinoid-binding protein (IRBP), a major 124 kDa glycoprotein in the interphotoreceptor matrix of Xenopus laevis. Characterization, molecular cloning and biosynthesis. J Cell Sci 1993; 105 (Pt 1):7-21.

69. Morris VB, Shorey CD. An electron microscope study of types of receptor in the chick retina. J Comp Neurol 1967; 129:313-40.

70. Blanks JC, Johnson LV. Specific binding of peanut lectin to a class of retinal photoreceptor cells. A species comparison. Invest Ophthalmol Vis Sci 1984; 25:546-57.

71. Xie HQ, Adler R. Green cone opsin and rhodopsin regulation by CNTF and staurosporine in cultured chick photoreceptors. Invest Ophthalmol Vis Sci 2000; 41:4317-23.

72. Porrello K, Bhat SP, Bok D. Detection of interphotoreceptor retinoid binding protein (IRBP) mRNA in human and cone-dominant squirrel retinas by in situ hybridization. J Histochem Cytochem 1991; 39:171-6.

73. Hollyfield JG, Varner HH, Rayborn ME, Bridges CD. Participation of photoreceptor cells in retrieval and degradation of components in the interphotoreceptor matrix. Prog Clin Biol Res 1985; 190:171-5.

74. Bruhn SL, Cepko CL. Development of the pattern of photoreceptors in the chick retina. J Neurosci 1996; 16:1430-9.

75. Gonzalez-Fernandez F. Interphotoreceptor retinoid-binding protein--an old gene for new eyes. Vision Res 2003; 43:3021-36.

76. van Veen T, Katial A, Shinohara T, Barrett DJ, Wiggert B, Chader GJ, Nickerson JM. Retinal photoreceptor neurons and pinealocytes accumulate mRNA for interphotoreceptor retinoid-binding protein (IRBP). FEBS Lett 1986; 208:133-7.

77. Hessler RB, Baer CA, Bukelman A, Kittredge KL, Gonzalez-Fernandez F. Interphotoreceptor retinoid-binding protein (IRBP): expression in the adult and developing Xenopus retina. J Comp Neurol 1996; 367:329-41.

78. Cunningham LL, Gonzalez-Fernandez F. Internalization of interphotoreceptor retinoid-binding protein by the Xenopus retinal pigment epithelium. J Comp Neurol 2003; 466:331-42.

79. Felsenstein J. PHYLIP -- Phylogeny Inference Package (Version 3.2). Cladistics 1989; 5:164-6.

Typographical corrections