Molecular Vision 2004; 10:383-391 <http://www.molvis.org/molvis/v10/a48/> Received 2 October 2002 | Accepted 29 May 2004 | Published 14 June 2004

Download Reprint

Alternative splicing of the APC gene in the neural retina and retinal pigment epithelium

Gregory I. Liou,^1,2 Sara Samuel,¹ Suraporn Matragoon,¹ Kathleen H. Goss,³ Irma Santoro,³ Joanna Groden,³ Richard C. Hunt,⁴ Fei Wang,⁵ Sheldon S. Miller,^5,6 Ruth B. Caldwell,² Anil K. Rustgi,⁷ Harinderjit Singh,¹ Dennis M. Marcus¹
 
 

Departments of ¹Ophthalmology and ²Cellular Biology & Anatomy, Medical College of Georgia, Augusta, GA; ³Howard Hughes Medical Institute, Department of Molecular Genetics, Biochemistry and Microbiology, University of Cincinnati College of Medicine, Cincinnati, OH; ⁴Department of Microbiology, University of South Carolina Medical School, Columbia, SC; ⁵School of Optometry and ⁶Department of Molecular and Cell Biology, University of California, Berkeley, CA; ⁷Division of Gastroenterology, University of Pennsylvania, Philadelphia, PA

Correspondence to: Gregory I. Liou, PhD, Department of Ophthalmology, Medical College of Georgia, 1120 15^th Street, Augusta, GA, 30912; Phone: (706) 721-4599; FAX: (706) 721-7913; email: giliou@mail.mcg.edu

Abstract

Purpose: Hypertrophy and hyperplasia of the retinal pigment epithelium (RPE) is associated with an inherited predisposition to human familial adenomatous polyposis coli, suggesting that expression of the adenomatous polyposis coli (APC) tumor suppressor may regulate RPE proliferation/differentiation. Distinctive APC isoforms exist in different cell types due to alternative splicing of the APC transcripts. We hypothesize that differences in expression patterns of APC protein isoforms are critical to RPE proliferation/differentiation.

Methods: To investigate these relationships, APC gene expression was characterized in the retinas and RPE from fetal and adult human and mouse, and in the epiretinal membranes (ERM) from 5 patients with proliferative vitreoretinopathy (PVR). Expression patterns of alternative splice-forms of APC transcripts were evaluated by comparative quantitative RT-PCR. Exon 1 of APC encodes a heptad repeat that confers the ability of APC to homodimerize. APC protein isoforms containing or lacking this heptad were characterized by western blot analysis and immunohistochemistry.

Results: Comparative quantitative RT-PCR demonstrated a predominant exon 1 containing, conventional APC splice-form in the early developing fetal RPE and retina, and in all the tested ERM samples from patients with PVR. This method also demonstrated an increased level of exon 1 lacking APC splice-form in the mature RPE and retina. Western blot analysis and immunofluorescence microscopy demonstrated the conventional APC only in the RPE, and the APC isoform without the first heptad repeat in both the retina and RPE. Immunofluorescence microscopy also demonstrated only the conventional APC in the ERM samples tested.

Conclusions: These results suggest that alternative splicing of APC leads to differential APC expression with potentially unique functions. APC isoform without the first heptad repeat may play a role in cell cycle cessation in the adult retina and RPE, and the down regulation of this APC isoform may contribute to the potential of RPE to migrate and proliferate.

Introduction

The morphologically and functionally polarized retinal pigment epithelium (RPE) has numerous functions including maintenance of adjacent retinal photoreceptor cells and formation of the outer blood-retinal barrier [1]. The stationary RPE cells in the normal adult eye, however, retain the ability to migrate and proliferate in response to a wide range of pathological insults [2]. In proliferative vitreoretinopathy (PVR), the most common cause of recurrent retinal detachment after successful surgical repair, epiretinal membranes (ERM) arise from dispersed vitreal RPE and may cause traction retinal detachment. Proliferative RPE may also be associated with exudative age-related macular degeneration (AMD), where choroidal neovascular membranes are often comprised of choroidal capillary endothelium and fibrovascular tissues surrounded by a rim of proliferating RPE [3]. In addition, the potential for successful RPE transplantation in various macular and retinal degenerations may rely on an ability to control the proliferative nature of transplanted and/or native RPE. Thus, an understanding of potential molecular factors critical for the migration and proliferation of RPE is of great importance.

One of the factors that may affect the proliferation and migration of RPE is the adenomatous polyposis coli (APC) protein. APC (2843 amino acids, molecular weight about 310 kDa) is a ubiquitously expressed tumor suppressor protein that is particularly important in the colorectal epithelial cell proliferation and migration [4]. The importance of APC to colorectal epithelium and RPE cell physiology has been suggested by the association of APC gene mutations with a familial form of human colorectal carcinoma known as familial adenomatous polyposis coli (FAP) [5,6], also characterized by congenital hypertrophy/hyperplasia of the RPE, or CHRPE [7]. Similar phenotypes of intestinal tumors and proliferative RPE were recapitulated in a mouse model of FAP, and emphasize the important role of APC in RPE proliferation and development [8,9].

The conventional APC transcript includes 17 exons: 1, 2, 3, 4, 5, 6, 7, 8, 9, 9A, 10, 10A, 11, 12, 13, 14, and 15, with exons 1, 9, and 10A being alternatively expressed [10,11]. Exon 1 of APC encodes the first of a series of heptad repeats [12], which are required for homodimerization [5,13]. The role of the APC as a tumor suppressor protein may depend upon its ability to homodimerize [12,14]. Additional splice-forms of APC lacking exon 1 have been identified in neuronal cells and tissues rich in non-dividing cells such as cerebellum, cerebrum, skeletal muscle and heart [15]. These exon 1 lacking transcripts contain one or more additional exons located 5' of exon 1 (Figure 1). Two of these exons, brain-specific (BS) and 0.3, contain in-frame translation initiation codons [16]. Additionally, a stop codon located upstream of the original translation initiation codon in exon 1 prevents the in-frame translation of BS or 0.3 unless exon 1 is excluded by splicing. Therefore, amino acids encoded by exon BS or 0.3 are not included in the conventional APC. Exon 1 lacking 0.3-APC or BS-APC transcripts and BS-APC protein (encoded by exons BS and 2-15) have been identified in adult human brain, but not in tissues containing mitotic cells. These APC proteins without the first heptad repeat are most likely involved in cell cycle cessation or differentiation [15,17].

The splicing pattern of the APC gene in the neural retina and RPE has not been studied, despite the fact that APC may be important to the physiology of these cells. Although both neural retina and RPE share the same neural tube origin and are mitotically inactive, it is hypothesized that the APC splicing pattern may account for the ability of the RPE to become proliferative and migratory in pathologic conditions. In this report, we determined the alternative splice-forms of APC transcripts and isoforms of APC protein in developing mammalian retina, RPE and ERM from patients with PVR.

Methods

Human ocular tissues

Human ocular tissues were obtained from deceased donors and were distributed by the Cooperative Human Tissue Network (Philadelphia, PA). Donor ages ranged between 58 and 92 years. Donor eyes were kept at 4 °C and the average interval between death and retina dissection was 26 h. Human fetal eyes (gestational age 16-20 weeks) were supplied by Advanced Bioscience Resources, Inc (Alameda, CA). Epiretinal membranes (PVR) were obtained from 5 consenting patients (P1 through P5). The research followed the tenets of the Declaration of Helsinki and was reviewed and approved by Human Assurance Committee of the Medical College of Georgia for using human post-mortem material.

Primary RPE cell culture from fetal human eyes

All reagents were purchased from Sigma unless otherwise indicated. Eyes were treated with 3 ml antibiotic-antimycotic solution 1 mg/ml gentamicin and 25 μg/ml Amphotericin B (Life Technologies, Rockville, MD) for 10 min [18]. After three washes with Hanks buffered salt solution, the anterior chamber and the vitreous were removed. The eyecup was incubated with 2 mg/ml Dispase (Life Technologies) at 37 °C for 30 min. After the retina was peeled off, sheets of RPE cells were peeled from the choroid and separated by repeated trituration in RPE culture medium, defined as follows: minimum essential medium Eagle (MEM), Alpha modification, supplemented with 5% heat-inactivated fetal bovine serum (FBS; Atlanta Biological, Atlanta, GA), 0.89 g/L L-alanine HCl, 1.5 g/L L-asparagine H₂O, 1.33 g/L aspartic acid, 1.47 g/L L-glutamic acid, 0.75 g/L glycine, 1.15 g/L L-proline, 1.05 g/L L-serine, 2 mM L-glutamine, 100,000 units/L penicillin, 20 mg/L streptomycin, 0.25 g/L taurine, 20 mg/L hydrocortisone, 13 ng/L tridothyron, 5 mg/L insulin, 5 mg/L transferrin, 5 mg/L selenium, 16 mg/L putrescine, 7.3 mg/L progesterone. Cells were pelleted by centrifuging at 500 g for 5 min and washed with RPE culture medium. Finally, the cells were resuspended in 5 ml RPE seeding medium (same as RPE culture medium except with 15% FBS), seeded on a T25 Primaria tissue culture flask (Becton Dickinson and Co., Franklin Lakes, NJ) and cultured in a humidified incubator at 37 °C and 5% CO₂. Cells were switched to RPE culture medium (5% FBS) one day later and maintained in that medium. After 3-5 weeks, the confluent cells were trypsinized with 0.25% trypsin (Life Technologies).

Primary RPE cell culture from human donor eyes

The anterior portion of the human donor eye, as well as lens, vitreous and retina were removed to expose the RPE cell layer according to a previously published method [19]. The eyecup was rinsed with Hank's buffered salt solution, filled with a solution of 0.5 g trypsin/0.2 g EDTA/ml (Life Technologies) and incubated at 37 °C for 15 min. The dislodged cells were aspirated and the trypsin digestion procedure was repeated. Suspended cells were washed in Ham's F-10 medium containing 10% FBS, calcium chloride, ITS plus (Life Technologies) and antibiotics. The cells were resuspended in the same medium or D-MEM/F-12 with L-glutamine.

Animal care

All procedures concerning animals in this study adhered to the ARVO Statement for the Care and Use of Animals in Ophthalmic and Vision Research. One to two month old C57BL/6 or BALB/C mice were obtained from Jackson Laboratory (Bar Harbor, ME). Mice were permitted ad libitum rodent diet and water and maintained on a 12 h light/dark cycle. For studies using developing mice, inbred C57BL/6 are used. Mating cages were set up by placing two females with each stud male in the late afternoon. Pregnancy was determined by removing the females the following morning and checking for the presence of a copulation plug. When a copulation plug was found, that day was designated embryonic day 0.

RNA preparation and comparative quantitative RT-PCR

Human eyes were bisected at the ora serrata and the anterior chamber and vitreous gel were removed. The retinas and eyecups were rinsed with ice cold, diethylpyrocarbonate (DEPC) treated phosphate buffered saline (PBS) and the RPE cells were collected with a camel hair brush into 0.5 ml of DEPC treated PBS. Beginning at embryonic day 12, mouse eyes were dissected from each fetus. Adult mouse eyes were dissected to obtain the retinas and eyecups. RNA was prepared from cells in culture, or from human and mouse tissues using total RNA isolation reagent kit, RNAwiz or ToTally RNA (Ambion, Austin, TX) according to the manufacturer's instructions. Both of these kits are based on the use of detergent, chaotropic salts and phenolic extraction to denature the RNase and to solubilize and extract the total RNA.

The identification and quantification of the alternative splice forms of APC transcripts, 0.3 APC or BS-APC containing or those forms lacking exon 1, was achieved by comparative quantitative RT-PCR (Ambion, Inc., Austin, TX) using mouse or human exons 0.3 and 3 or BS and 3 primer pairs [15]. The mouse exon 0.3 primer, GAGACAGAATGGAGGTGCTGC, and exon 3 antisense primer, TTTCAAGCTCTTCTAGATACCC, amplify a fragment of 471 and 318 bp in the presence and absence of exon 1, respectively. The human exon 0.3 primer (same as mouse) and exon 3 antisense primer, CTCTCTTTCTCAAGTTCTTCTA, amplify a fragment of 477 and 324 bp in the presence and absence of exon 1, respectively. The human exon BS primer, GCTCTACCCCATTGAAAGGC, and exon 3 antisense primer amplify a fragment of 593 and 440 bp in the presence and absence of exon 1, respectively. Briefly, first-strand cDNA synthesis was performed on 2 μg DNase treated RNA. The individual cDNA species were amplified in a reaction containing a cDNA aliquot, PCR buffer, and MgCl₂. Reactions were initiated by incubating at 95 °C for 15 min and PCR (94 °C, 40 s; 58 °C, 30 s; 72 °C, 30 s) performed for a suitable number of cycles to ensure that amplification was within exponential phase (0.3 APC, 25 or 26 cycles; BS-APC, 24 cycles), followed by a final extension at 72 °C for 7 min. The abundant internal standard, β-actin, was amplified to the levels comparable to 0.3 APC or BS-APC by using primer and competimer mixtures (Ambion) at various ratios. Interexperimental variations were avoided by performing all amplifications in a single run.

PCR products were separated in 1.6% agarose or 8% polyacrylamide gel electrophoresis. Gels were stained with ethidium bromide, photographed under ultraviolet illumination, and the appropriate product size determined by comparison with a 100 bp or 1 kb DNA ladder (Life Technologies).

Western blot analysis

Human donor eyes were bisected as above, and the retinas and eyecups were rinsed with ice cold phosphate buffered saline containing 0.5 mM phenylmethylsulonylfluoride (PMSF). The RPE cells were collected with a camel hair brush into 0.5 ml of lysis buffer 50 mM tris-HCl, pH 7.5, 150 mM NaCl, 0.5% NP-40, 1 mM EDTA, 0.2 mM PMSF and 100 μl/ml of proteinase inhibitor cocktail containing 4-(2-aminoethyl) benzenesulfonylfluoride, pepstatin A, trans-epoxysuccinyl-L-leucylamido(4-guanidino) butane, bestatin, leupeptin and aprotinin (Sigma, St. Louis, MO). Retinal tissue and RPE cells were homogenized using a Dounce homogenizer with a tight fitting pestle and cell lysates were cleared by centrifugation at 14,000 rpm (16,000x g) for 20 min at 4 °C. Proteins of 100 μg, determined by Bio Rad Protein Assay (Detergent Compatible), were separated by SDS-PAGE on 4.5% to 9% gradient acrylamide mini-gels containing 25% glycerin and electrophoretically transferred to a nitrocellulose membrane (Schleicher and Shuell, Keene, NH). The antibodies used, mouse monoclonal antibodies Ab-1 (Oncogene Research Products, Cambridge, MA; Calbiochem, San Diego, CA) and C-20 (Santa Cruz Biotechnology Inc, Santa Cruz, CA), and rabbit polyclonal antibody anti-BS, are specific for the amino (N)-terminal 35 amino acids encoded by exon 1, C-terminus encoded by exon 15 and an undefined epitope encoded by exon BS [17], respectively. The antigen/antibody reaction was visualized by development with enhanced chemiluminescence (Amersham). For antibody stripping from the nitrocellulose membrane, the antibody stripping solution (Chemicon, Temecula, CA) was used.

Immunofluorescence of APC

Localization of APC in adult albino mouse (BALB/C) retina, human donor eye and ERM (PVR) was visualized by immunofluorescence with the Ab-1 and anti-BS antibodies described above. Mouse eyes and ERM were frozen in OCT. Human donor eye was fixed in 4% paraformaldehyde and paraffin-embedded. The 10 μm thick sections on slides were fixed with ice-cold acetone and blocked with 4% normal goat serum. The slides were incubated overnight at 4 °C with a 1:50 dilution of Ab-1 or a 1: 2000 dilution of BS. After rinsing, all samples were incubated overnight at 4 °C with a 1:1000 dilution of Oregon Green-labeled goat anti-mouse or goat anti-rabbit IgG secondary antibody (Molecular Probes, Eugene, OR). Controls were prepared in the same manner, except that the primary antibody was replaced with normal rabbit serum. Coverslips were mounted under Permafluor mounting medium. Sections were optically sectioned (z series) using a Nikon Diaphot 200 Laser Scanning Confocal Imaging System (Molecular Dynamics, Sunnyvale, CA). Images were analyzed using the Image Space software package (Molecular Dynamics).

Results

Analysis of APC splice-forms in the retina and RPE

Alternative splice-forms of APC have been identified in different tissues using RT-PCR [15]. Transcripts encoding conventional APC have been identified in tissues with dividing cells, and those lacking exon 1 have been identified in tissues rich in non-dividing or terminally differentiated cells. To determine whether alternative splice-forms of APC exist in the retina and RPE that may regulate cell growth and development, we analyzed mouse and human 0.3 APC or BS-APC transcripts with or without exon 1 in these tissues during development and in the adult by RT-PCR. The composition of the splice-forms was confirmed by sequencing after cloning in pGEM-T Easy (Promega, Madison, WI; data not shown). As shown in Figure 2A, in the developing mouse eye prior to embryonic day 16-17 (E16-17), both non-quantitative (top panel) and comparative quantitative RT-PCR (lower panel) indicated that the exon 1 containing 0.3 APC transcript was the only splice-form. At E16 and later, the exon 1 containing and exon 1 lacking 0.3 APC transcripts were both evident in the brain, neural retina, eyecup and eye. To determine the APC transcripts specific to the RPE and neural retina, the splice-forms of 0.3 APC and BS-APC transcripts in the fetal (gestation time, 17 week) and adult human retina and RPE were analyzed by comparative quantitative RT-PCR. As shown in Figure 2B, the exon 1 lacking 0.3 or BS-APC transcript in the fetal human retina or RPE was much lower than that in the adult tissue. In the adult tissues, the exon 1 lacking BS-APC transcript in the RPE was lower than that in the retina. These results suggest that the exon 1 containing, conventional APC transcript plays a role in dividing cells during embryonic retinal/RPE development. On the other hand, higher levels of the exon 1 lacking APC transcripts in the adult retina and brain suggest a role for these isoforms in terminal differentiation or in the cessation of growth. The relatively lower level of the exon 1 lacking BS-APC transcript in mature RPE suggest that RPE cells may not be terminally differentiated and that APC may be critical to RPE migration and proliferation in pathologic conditions.

Identification of the APC protein isoforms in retina and RPE

Conventional APC protein has been identified in all epithelial tissues containing mitotic cells. BS-APC protein without the first heptad repeat has been identified in adult human brain, but not in tissues containing mitotic cells [17]. Conventional APC and BS-APC protein isoforms in adult human neural retina and RPE were determined by western blot analysis using antibodies specific for exon 1 (Ab-1), exon BS (BS) and exon 15 (C-20). Antibody C-20 is used to identify full-length APC as well as all the internal splice-variant isoforms. Antibodies BS and C-20 have identified full-length APC of about 310 kDa and internal splice-variant species of 290, 200, 150 and 100 kDa [17]. As shown in Figure 3, Ab-1 detected a full-length, conventional APC band of about 310 kDa in the RPE, but not in the retina. Anti-BS antibody, on the other hand, detected multiple bands of 310, 290, 150 and 100 in the retina, but much lower levels of these bands in the RPE. Antibody C-20 detected almost comparable levels of these bands in the RPE and retina. These results suggest that while similar levels of total APC isoforms are expressed in the retina and RPE, higher level of conventional APC protein is expressed in the RPE, and higher level of BS-APC protein is expressed in the retina.

Localization of the APC protein isoforms in the retina and RPE

To localize the isoforms of APC protein in the neural retina and RPE in situ, confocal immunofluorescence microscopy of cryosectioned mouse eyes was performed. Sections were compared to slides stained with hematoxylin and eosin (Figure 4A). Sections stained with BS antibody demonstrated immunofluorescence in both the neural retina and RPE (Figure 4B). In the neural retina, BS-APC is mainly localized in the inner and outer plexiform layers, and in the inner segment of the photoreceptors. In contrast, sections stained with Ab-1 antibody demonstrated an RPE-dominating immunofluorescence (Figure 4C). Sections stained with normal serum and with fluorescence-conjugated secondary antibody showed only minor immunofluorescence in the choroid/sclera (Figure 4D). These results demonstrated that while both BS-APC and conventional APC are present in the RPE, only BS-APC is expressed in the neural retina.

Identification of APC isoforms in the epiretinal membranes

The ERM of PVR contains migratory and proliferative cells of RPE origin [2]. To test the hypothesis that the proliferative nature of RPE in the ERM of PVR is associated with down-regulation of BS-APC, the expression of the alternative splice-forms of the APC gene and cytokeratin-18 gene (epithelial cell marker) in adult human RPE and in the ERM of three patients with PVR (P1, P2, and P4) were analyzed by comparative quantitative RT-PCR. As shown in Figure 5, exon 1 containing and exon 1 lacking BS-APC transcripts are co-expressed in the RPE. However, exon 1 lacking BS-APC is not detected in the ERM from one of the patients (P2). Similar results are observed in the ERM of the other two patients (data not shown). Both the RPE and ERM express comparable levels of cytokeratin-18 gene.

The in situ localization of the isoforms of APC protein in adult human retina and RPE, and in the ERM of two patients with PVR (P3 and P5) was determined by immunohistochemical analysis. Confocal immunofluorescence microscopy demonstrated that cytokeratin, conventional APC and BS-APC are all expressed in the RPE, and only BS-APC is expressed in the neural retina (Figure 6, top panels). In the ERM of two patients, cytokeratin and conventional APC, but not BS-APC, are expressed in the RPE-like cells (Figure 6, lower panels, two sections from the ERM of patient P5; result for patient P3 not shown). These findings suggest down-regulation of BS-APC isoform may contribute to the potential of RPE to migrate and proliferate.

Discussion

Mutation of the APC gene is responsible for familial adenomatous polyposis coli (FAP), an autosomal dominantly inherited disease of the colon and other polyposis syndromes [5,6]. Patients with FAP may present with ocular manifestations in the form of bilateral and multiple pigmented lesions of the RPE, which represent congenital hypertrophy/hyperplasia and hamartomatous proliferation of the RPE (CHRPE) [7]. The association of APC gene mutation and CHRPE implicates APC as a regulatory gene of RPE proliferation.

APC expression in the RPE or retina has not been extensively studied despite the fact that APC is more highly expressed in the central nervous neurons than in any other tissue as reported by Bhat et al. [20]. Analysis of APC expression in brain with in situ hybridization by these authors showed that APC mRNA was expressed throughout the rat brain during development and remained abundant in the adult. In the embryonic rat brain, APC mRNA was particularly abundant in cortical, cerebellar, and retinal layers containing newly formed, post-mitotic neurons, suggesting that APC may contribute to suppressing neuronal proliferation. However, the study by these authors was carried out using probes to regions of APC downstream of exon 2, which did not allow determination of the temporal expression and distribution of transcripts likely to encode BS-APC or conventional APC proteins.

In this study, we have demonstrated that conventional APC (exon 1 containing APC transcript) is the predominant splice-form of APC transcript in the neural retinal and RPE cells during early embryonic eye development. As these tissues become mature, the exon 1 lacking splice-forms of APC transcript are also expressed. This is more evident for BS-APC in the neural retina. We have further demonstrated that conventional APC is the predominant protein isoform in the adult RPE, while APC protein lacking the first heptad repeat (BS-APC) is the predominant isoform in the adult neural retina. The presence of conventional APC transcripts in early developing neural retina and RPE is not unexpected, as conventional APC transcripts are present in dividing cells [15,17]. The expression of the conventional APC protein isoform in adult RPE cells is intriguing. RPE cells, like neural retinal cells, are derived from the same neuroectodermal precursors in the neural tube. Although RPE cells are stationary and remain largely non-proliferative, these cells in adult eyes are not terminally differentiated. The predominant BS-APC protein in the adult retina suggests a role in terminal differentiation. On the other hand, the co-expression of BS-APC and conventional APC isoforms in the adult RPE suggest that while BS-APC plays a role in maintaining cell differentiation, conventional APC may play a critical role in maintaining the potential for RPE proliferation and migration when BS-APC is down-regulated. We have demonstrated the association of BS-APC down-regulation with RPE proliferation in the proliferative RPE-like cells in the epiretinal membranes of PVR.

In this study, we have noticed that the presence of the transcripts for the BS-APC and conventional APC isoforms does not correlate with the corresponding proteins found. For example, in the adult neural retina or RPE, conventional APC and BS-APC transcripts are co-present, but only either the conventional APC protein or BS-APC protein is present in these tissues. A possible explanation is that postranscriptional/translational regulation may play a role in this discrepancy. In the mature neural retina, exon 1 lacking BS-APC transcript is preferentially translated whereas in the mature RPE, conventional APC transcript is preferentially translated. Further studies are required to resolve the mechanism of regulation.

APC functions through its interactions with, and down-regulation of, β-catenin [12,14]. The latter is a bi-functional molecule that mediates cellular adhesion when associated with E-cadherin at the plasma membrane, or, in the wnt/frizzled or hepatocyte growth factor/c-met signaling pathway, stimulates the transcription of growth-promoting genes when associated with certain transcription factors [21]. APC may also be involved in cell migration when associated with microtubules in epithelial cell membranes [22]. Recently, the secreted frizzled-related protein-5 [23] and N- and E-cadherins [24] (unpublished observations) have been identified in the RPE. Moreover, hepatocyte growth factor/c-met [25-27] and β-catenin [27] may be involved in the regulation of RPE migration. Further study of the relationship between APC, cadherins and β-catenin may provide molecular insight into the regulatory role of APC in RPE proliferation.

In conclusion, our results in developing and adult retinal tissues suggest that splicing of APC may lead to differential APC expression with potentially unique functions. APC isoform without the first heptad repeat may play a role in cell cycle cessation in the adult retina and RPE, and the down-regulation of this APC isoform may contribute to the potential of RPE to migrate and proliferate.

Acknowledgements

The authors gratefully acknowledge the assistance of Ms. Brenda Headrick for her technical support in the histology of the human eye and ERM and Ms. Penny Roon for her support in the histology of the mouse eye. We also thank Dr. Sylvia Smith for her insight and comments in the manuscript and Ms. Brenda Sheppard for her assistance in preparing the manuscript.

Supported by the Combined Intramural Grants Program from Medical College of Georgia (GIL), an unrestricted departmental award from Research to Prevent Blindness Inc., New York, NY (GIL, RBC, SEB, and DMM), American Health Assistance Foundation, Rockville, MD (GIL), Knights Templar Education Foundation, Atlanta, GA (GIL), grants EY04618 and EY11766 (RBC), EY10516 (RCH), EY12711 (DMH) CA63507 (JG), EY02205 (SSM) and DK56645 (AKR) from the National Institutes of Health. JG is an Assistant Investigator with the Howard Hughes Medical Institute.

References

1. Zhao S, Rizzolo LJ, Barnstable CJ. Differentiation and transdifferentiation of the retinal pigment epithelium. Int Rev Cytol 1997; 171:225-66.

2. Grierson I, Hiscott P, Hogg P, Robey H, Mazure A, Larkin G. Development, repair and regeneration of the retinal pigment epithelium. Eye 1994; 8:255-62.

3. Grossniklaus HE, Green WR. Histopathologic and ultrastructural findings of surgically excised choroidal neovascularization. Submacular Surgery Trials Research Group. Arch Ophthalmol 1998; 116:745-9.

4. Polakis P. The adenomatous polyposis coli (APC) tumor suppressor. Biochim Biophys Acta 1997; 1332:F127-47.

5. Groden J, Thliveris A, Samowitz W, Carlson M, Gelbert L, Albertsen H, Joslyn g, Stevens J, Spirio L, Robertson M, Sargant L, Krapcho K, Wolff E, Burt R, Hughes J, Warrington J, McPherson J, Wasmuth J, LePaslier D, Abderrahim H, Cohen D, Leppert M, White R. Identification and characterization of the familial adenomatous polyposis coli gene. Cell 1991; 66:589-600.

6. Nishisho I, Nakamura Y, Miyoshi Y, Miki Y, Ando H, Horii A, Koyama K, Utsunomiya J, Baba S, Hedge P. Mutations of chromosome 5q21 genes in FAP and colorectal cancer patients. Science 1991; 253:665-9.

7. Olschwang S, Tiret A, Laurent-Puig P, Muleris M, Parc R, Thomas G. Restriction of ocular fundus lesions to a specific subgroup of APC mutations in adenomatous polyposis coli patients. Cell 1993; 75:959-68.

8. Marcus DM, Rustgi AK, Defoe D, Brooks SE, McCormick RS, Thompson TP, Edelmann W, Kucherlapati R, Smith S. Retinal pigment epithelium abnormalities in mice with adenomatous polyposis coli gene disruption. Arch Ophthalmol 1997; 115:645-50.

9. Marcus DM, Rustgi AK, Defoe D, Kucherlapati R, Edelmann W, Hamasaki D, Liou GI, Smith SB. Ultrastructural and ERG findings in mice with adenomatous polyposis coli gene disruption. Mol Vis 2000; 6:169-77 <http://www.molvis.org/molvis/v6/a23/>.

10. Horii A, Nakatsuru S, Ichii S, Nagase H, Nakamura Y. Multiple forms of the APC gene transcripts and their tissue-specific expression. Hum Mol Genet 1993; 2:283-7.

11. Sulekova Z, Reina-Sanchez J, Ballhausen WG. Multiple APC messenger RNA isoforms encoding exon 15 short open reading frames are expressed in the context of a novel exon 10A-derived sequence. Int J Cancer 1995; 63:435-41.

12. Su LK, Vogelstein B, Kinzler KW. Association of the APC tumor suppressor protein with catenins. Science 1993; 262:1734-7.

13. Joslyn G, Carlson M, Thliveris A, Albertsen H, Gelbert L, Samowitz W, Groden J, Stevens J, Spirio L, Robertson M, Sargeant L, Krapcho K, Wolff E, Burt R, Hughes JP, Warrington J, McPherson J, Wasmuth J, LePaslier D, Abderrahim H, Cohen D, Leppert M, White R. Identification of deletion mutations and three new genes at the familial polyposis locus. Cell 1991; 66:601-13.

14. Rubinfeld B, Souza B, Albert I, Muller O, Chamberlain SH, Masiarz FR, Munemitsu S, Polakis P. Association of the APC gene product with beta-catenin. Science 1993; 262:1731-4.

15. Santoro IM, Groden J. Alternative splicing of the APC gene and its association with terminal differentiation. Cancer Res 1997; 57:488-94.

16. Kozak M. The scanning model for translation: an update. J Cell Biol 1989; 108:229-41.

17. Pyles RB, Santoro IM, Groden J, Parysek LM. Novel protein isoforms of the APC tumor suppressor in neural tissue. Oncogene 1998; 16:77-82.

18. Wang F, Rendahl K, Manning W, Quiroz D, Coyne M, Miller SS. A rat model of choroidal neovascularization (CNV) induced by adeno-associated virus (AAV) mediated expression of vascular endothelial growth factor (VEGF). Invest Ophthalmol Vis Sci 2001; 42:S225.

19. Hunt RC, Dewey A, Davis AA. Transferrin receptors on the surfaces of retinal pigment epithelial cells are associated with the cytoskeleton. J Cell Sci 1989; 92 (Pt 4):655-66.

20. Bhat RV, Baraban JM, Johnson RC, Eipper BA, Mains RE. High levels of expression of the tumor suppressor gene APC during development of the rat central nervous system. J Neurosci 1994; 14:3059-71.

21. Dale TC. Signal transduction by the Wnt family of ligands. Biochem J 1998; 329 (Pt 2):209-23.

22. Nathke IS, Adams CL, Polakis P, Sellin JH, Nelson WJ. The adenomatous polyposis coli tumor suppressor protein localizes to plasma membrane sites involved in active cell migration. J Cell Biol 1996; 134:165-79.

23. Chang JT, Esumi N, Moore K, Li Y, Zhang S, Chew C, Goodman B, Rattner A, Moody S, Stetten G, Campochiaro PA, Zack DJ. Cloning and characterization of a secreted frizzled-related protein that is expressed by the retinal pigment epithelium. Hum Mol Genet 1999; 8:575-83.

24. Burke JM, Cao F, Irving PE, Skumatz CM. Expression of E-cadherin by human retinal pigment epithelium: delayed expression in vitro. Invest Ophthalmol Vis Sci 1999; 40:2963-70.

25. He PM, He S, Garner JA, Ryan SJ, Hinton DR. Retinal pigment epithelial cells secrete and respond to hepatocyte growth factor. Biochem Biophys Res Commun 1998; 249:253-7.

26. Lashkari K, Rahimi N, Kazlauskas A. Hepatocyte growth factor receptor in human RPE cells: implications in proliferative vitreoretinopathy. Invest Ophthalmol Vis Sci 1999; 40:149-56.

27. Liou GI, Matragoon S, Samuel S, Behzadian MA, Tsai NT, Gu X, Roon P, Hunt DM, Hunt RC, Caldwell RB, Marcus DM. MAP kinase and beta-catenin signaling in HGF induced RPE migration. Mol Vis 2002; 8:483-93 <http://www.molvis.org/molvis/v8/a59/>.