Molecular Vision 2001; 7:283-287 <http://www.molvis.org/molvis/v7/a40/> Received 10 October 2001 | Accepted 2 December 2001 | Published 10 December 2001

Download Reprint

Sequence and structure of the mouse gene for RPE65

Ana Boulanger, Suyan Liu, Shirley Yu, T. Michael Redmond
 
 

Laboratory of Retinal Cell and Molecular Biology, National Eye Institute, National Institutes of Health, Bethesda, MD

Correspondence to: T. Michael Redmond, Ph.D., NEI-LRCMB, NIH, Building 6, Room 339, 6 Center Drive, MSC 2740, Bethesda, MD, 20892-2740; Phone: (301) 496-0439; FAX: (301) 402-1883; email: redmond@helix.nih.gov

Abstract

Purpose: To determine the genomic organization of the mouse gene for the retinal pigment epithelium (RPE) specific protein RPE65.

Methods: A genomic clone containing the entire Rpe65 gene was isolated from a mouse genomic P1 library. Fragments of this clone were subcloned and sequenced by automated fluorescent dideoxy DNA sequencing and analyzed. Direct sequencing of PCR amplification products was used to complete the structure. Primer extension analysis was used to determine the transcription start site.

Results: Southern hybridization of restriction digests of mouse genomic DNA reveals a likely single autosomal gene for Rpe65 with no evidence of pseudogenes. Sequence analysis of the mouse P1 clone for Rpe65 and fragments thereof reveals 14 exons distributed over 27 kbp. The transcription start site is located 57 bp upstream of the initiation codon. The protein encoded by the mouse Rpe65 gene is highly conserved when compared with RPE65s from other species.

Conclusions: RPE65 is a highly conserved protein and it appears that the genes for the mouse and human RPE65s, at least, are also conserved in overall structure.

Introduction

A major function of the retinal pigment epithelium (RPE) is the production of 11-cis retinal chromophore required for the regeneration of photoreceptor opsins, in a process termed the visual cycle [1]. A series of enzymes and retinoid binding proteins is known to be involved in the successive steps of the visual cycle. Most of the steps have been identified and many have been characterized. Despite this, the identity of the protein(s) catalyzing the central all-trans to 11-cis isomerization reaction is still not known though its enzymology has been well studied [2-4]. Most of the proteins known to be associated with the visual cycle are highly preferentially expressed in the RPE. One such protein is RPE65 [5,6]. Though its precise role in the visual cycle is still debated, its absence, such as in the Rpe65-deficient mouse [7], the Briard dog model of congenital stationary night-blindness [8-10], and in presumed null human RPE65 gene mutations [11-13], results in severe blindness. Retinoid analysis of the retinae of the Rpe65-deficient mouse reveals severe depletion of 11-cis retinoids (no or very little rhodopsin) and over-accumulation of all-trans-retinyl esters in the RPE [7]. This is suggestive of a role for RPE65 in the all-trans to 11-cis isomerization of vitamin A.

The human gene for RPE65 has been cloned and sequenced [14]. It consists of 14 exons spread over about 25 kb pairs of genomic DNA. The chromosomal localizations of both the human and mouse genes have been identified, at 1p31 [14,15] and distal 3 [15], respectively. Though certain aspects of the mouse gene have been reported upon, including the targeted disruption of the mouse Rpe65 gene [7], and the analysis of the promoter function of the 5' flanking region of the mouse Rpe65 gene [16], the structure of the gene itself has not.

In this brief report we present the structure of the mouse Rpe65 gene, the sequence of the intron/exon boundaries, and the determination of the start site of the gene. In general, it is quite similar to that observed for the human gene [14], further extending the high degree of conservation of RPE65 to the organization of the homologous genes.

Methods

Genomic Southern blot analysis of the mouse Rpe65 gene

A mouse Genoblot containing mouse genomic DNA digested with EcoR I, Hind III, BamH I, Pst I and Bgl II was purchased from Clontech (Palo Alto, CA). This blot was prehybridized with QuikHyb (Stratagene, La Jolla, CA) and hybridized with a random primed [17] bovine cDNA probe [6]. The blot was washed to a final stringency of 0.1 X SSC+ 0.1% SDS at 63°C.

Cloning and Sequencing of mouse Rpe65 gene

A P1 clone containing the entire mouse Rpe65 gene was isolated employing a PCR screening method (Incyte Genomics, St. Louis, MO). Restriction fragments containing the 5' region of the mouse Rpe65 gene were identified by Southern blot hybridization to a random-primed ³²P-labeled bovine cDNA 5' end probe [6]. EcoR I and BamH I restriction fragments thereof were separated on agarose gels, excised, purified by binding to GeneClean II (Bio101/Qbiogene, Carlsbad, CA) and subcloned into pBluescript II SK- (Stratagene, La Jolla, CA). pBluescript II subclones containing the 5' region of the RPE65 gene were sequenced. Double-stranded dideoxy sequencing was performed using the Dye Terminator cycle sequencing protocol on a model 373A automated fluorescent DNA sequencer (Applied Biosystems/Perkin Elmer, Foster City, CA). A primer-walking sequencing strategy was employed. The sequences of some exons and introns were obtained from direct sequencing of PCR amplification products using the mouse Rpe65 P1 clone as template and employing SuperTaq Taq polymerase (Ambion, Austin, TX). Each base of each clone/PCR product was covered at least twice on both strands. Some regions of particular difficulty (repetitive sequences, etc.) were sequenced up to 8 times in each direction. Sequences were assembled using the Applied Biosystems AutoAssembler (v.1.3.0) and Sequencher v.3.1.1 (Gene Codes Corp., Ann Arbor, MI) software.

Identification of transcription initiation site

Animal studies were conducted in accordance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. Total RNA was isolated from mouse eyes by the method of Chomczynski and Sacchi [18]. Primer extension was carried out as described in the Primer Extension System-AMV Reverse Transcriptase kit (Promega, Madison, WI). The antisense oligonucleotide (5' CATTTTCTTCCAGTGAAGATTAGAGAGAG 3') based on mouse RPE65 cDNA was labeled in the presence of 60 mCi g³²P and hybridized with 12 mg of total RNA extracted from RPE/choroid of mice eyes. The first strand cDNA was synthesized using AMV reverse transcriptase (Promega) at 42 °C for 30 min and the fragments produced were analyzed by 6% denaturing sequencing gel electrophoresis (Stratagene).

Sequence analysis

DNA and protein sequences were analyzed and aligned using the AutoAssembler (v.1.3; Applied Biosystems, Foster City, CA), Sequencher (v. 3.1.1) and MacVector package (v. 6.5.3; Oxford Molecular Group, Madison, WI).

Results & Discussion

Southern blot analysis of restriction digests of mouse genomic DNA, hybridized to a bovine cDNA probe, revealed a simple restriction pattern (Figure 1), suggestive of a single gene and excluding the existence of pseudogenes. This is consistent with the assignation of the mouse chromosomal locus where no cross-hybridizing locus was seen [15].

The structure of the mouse Rpe65 gene is shown in Figure 2. The subcloned 5' end fragments of the gene are shown above. One such clone, E1-12, was found to contain the first three exons of mouse Rpe65 and intervening introns, as well as 2.8 kb of 5' flanking region. Another clone, E2-8, contained exons 4, 5, and 6 and intervening introns. Exons 7 and beyond were sequenced from PCR amplification products using the mouse P1 clone as template. The gene has 14 exons distributed over 27 kb. The intron-exon boundaries, determined by comparison of genomic sequence with the mouse RPE65 cDNA (unpublished data), are presented in Figure 3. Intron length varies from 88 bp to about 8 kbp. The sizes of the longer introns F, J and M were estimated from agarose gel electrophoresis of PCR products amplified using primers flanking these introns (data not shown). In general, the donor/acceptor sites corresponded to the GT/AG rule, though not always perfectly. This organization is generally quite similar to that found for the human RPE65 gene [14] which also has 14 exons. The exon breaks found for the mouse gene correspond exactly to those seen in the human gene [14]. The sequences have been deposited in GenBank under the accession numbers AF432266, AF432267, and AF432268.

The transcription initiation site was determined by primer extension analysis using a primer complementary to the known 5' end of mouse RPE65 cDNA. One elongation product was identified from the RNA of RPE65-expressing mouse RPE cells (Figure 4), but it was not produced when the primer extension reaction was carried out without RNA (not shown). The transcription start site corresponds to the one deduced from the bovine RPE65 cDNA but differs by one nucleotide from that of the human sequence [14].

The deduced protein sequence for mouse RPE65 is shown in Figure 5 in comparison with the sequences for rat, human, bovine, dog, chicken, and salamander RPE65s. Sequence conservation is, in general very high with mouse RPE65 being 95% identical to its human, dog and cow homologs.

In conclusion, the organization and structure of the mouse Rpe65 gene is quite similar to that of the homologous human RPE65 gene. When taken together with the obviously close homology at the protein level and the degree of similarity of the 5' flanking region [16], these data speak to the marked conservation of this gene in all aspects of its organization, regulation, and expression.

Acknowledgements

We wish to thank Jeff Kammer for help in DNA cloning and sequencing.

References

1. Saari JC. Retinoids in photosensitive systems. In: Sporn MB, Roberts AB, Goodman DS, editors. The Retinoids: biology, chemistry and medicine. 2nd ed. New York: Raven; 1994. p. 351-85.

2. Bernstein PS, Law WC, Rando RR. Biochemical characterization of the retinoid isomerase system of the eye. J Biol Chem 1987; 262:16848-57.

3. Winston A, Rando RR. Regulation of isomerohydrolase activity in the visual cycle. Biochemistry 1998; 37:2044-50.

4. McBee JK, Kuksa V, Alvarez R, de Lera AR, Prezhdo O, Haeseleer F, Sokal I, Palczewski K. Isomerization of all-trans-retinol to cis-retinols in bovine retinal pigment epithelial cells: dependence on the specificity of retinoid-binding proteins. Biochemistry 2000; 39:11370-80.

5. Hamel CP, Tsilou E, Harris E, Pfeffer BA, Hooks JJ, Detrick B, Redmond TM. A developmentally regulated microsomal protein specific for the pigment epithelium of the vertebrate retina. J Neurosci Res 1993; 34:414-25.

6. Hamel CP, Tsilou E, Pfeffer BA, Hooks JJ, Detrick B, Redmond TM. Molecular cloning and expression of RPE65, a novel retinal pigment epithelium-specific microsomal protein that is post-transcriptionally regulated in vitro. J Biol Chem 1993; 268:15751-7.

7. Redmond TM, Yu S, Lee E, Bok D, Hamasaki D, Chen N, Goletz P, Ma JX, Crouch RK, Pfeifer K. Rpe65 is necessary for production of 11-cis-vitamin A in the retinal visual cycle. Nat Genet 1998; 20:344-51.

8. Narfstrom K, Wrigstad A, Nilsson SE. The Briard dog: a new animal model of congenital stationary night blindness. Br J Ophthalmol 1989; 73:750-6.

9. Aguirre GD, Baldwin V, Pearce-Kelling S, Narfstrom K, Ray K, Acland GM. Congenital stationary night blindness in the dog: common mutation in the RPE65 gene indicates founder effect. Mol Vis 1998; 4:23 <http://www.molvis.org/molvis/v4/a23/>.

10. Veske A, Nilsson SE, Narfstrom K, Gal A. Retinal dystrophy of Swedish briard/briard-beagle dogs is due to a 4-bp deletion in RPE65. Genomics 1999; 57:57-61.

11. Marlhens F, Bareil C, Griffoin JM, Zrenner E, Amalric P, Eliaou C, Liu SY, Harris E, Redmond TM, Arnaud B, Claustres M, Hamel CP. Mutations in RPE65 cause Leber's congenital amaurosis. Nat Genet 1997; 17:139-41.

12. Gu SM, Thompson DA, Srikumari CR, Lorenz B, Finckh U, Nicoletti A, Murthy KR, Rathmann M, Kumaramanickavel G, Denton MJ, Gal A. Mutations in RPE65 cause autosomal recessive childhood-onset severe retinal dystrophy. Nat Genet 1997; 17:194-7.

13. Morimura H, Fishman GA, Grover SA, Fulton AB, Berson EL, Dryja TP. Mutations in the RPE65 gene in patients with autosomal recessive retinitis pigmentosa or leber congenital amaurosis. Proc Natl Acad Sci U S A 1998; 95:3088-93.

14. Nicoletti A, Wong DJ, Kawase K, Gibson LH, Yang-Feng TL, Richards JE, Thompson DA. Molecular characterization of the human gene encoding an abundant 61 kDa protein specific to the retinal pigment epithelium. Hum Mol Genet 1995; 4:641-9.

15. Hamel CP, Jenkins NA, Gilbert DJ, Copeland NG, Redmond TM. The gene for the retinal pigment epithelium-specific protein RPE65 is localized to human 1p31 and mouse 3. Genomics 1994; 20:509-12.

16. Boulanger A, Liu S, Henningsgaard AA, Yu S, Redmond TM. The upstream region of the Rpe65 gene confers retinal pigment epithelium-specific expression in vivo and in vitro and contains critical octamer and E-box binding sites. J Biol Chem 2000; 275:31274-82.

17. Feinberg AP, Vogelstein B. A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal Biochem 1983; 132:6-13.

18. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 1987; 162:156-9.

Typographical corrections