Molecular Vision 2001; 7:1-5 <http://www.molvis.org/molvis/v7/a1/> Received 2 November 2000 | Accepted 24 December 2000 | Published 2 January 2001

Download Reprint

Quantitation of PAX6 and PAX6(5a) transcript levels in adult human lens, cornea, and monkey retina

Weiyan Zhang,¹ Kveta Cveklova,² Brian Oppermann,¹ Marc Kantorow,¹ Ales Cvekl²
 
 

¹Department of Biology, West Virginia University, Morgantown, WV; ²The Departments of Ophthalmology & Visual Sciences and Molecular Genetics, Albert Einstein College of Medicine, Bronx, NY

Correspondence to: Ales Cvekl, Ph.D., Departments of Ophthalmology & Visual Sciences and Molecular Genetics, Albert Einstein College of Medicine, 909 Ullmann, 1300 Morris Park Avenue, Bronx, NY, 10461; Phone: (718) 430-3217; FAX: (718) 430-8778; email: cvekl@aecom.yu.edu

Abstract

Purpose: PAX6 is a critical regulator of the developing lens, other ocular tissues, central nervous system, and pancreas. There are two alternatively spliced forms of the protein, PAX6 and PAX6(5a), that may have different regulatory functions. This study was designed to determine the amounts of PAX6 and PAX6(5a) transcripts present in adult human lens epithelium and fibers, human cornea and monkey retina.

Methods: PAX6 and PAX6(5a) transcript levels were monitored in microdissected lens epithelia, lens fibers, whole lens, cornea, and retina by competitive RT-PCR. The levels of TBP/TFIID were examined in adult human lens epithelium and fibers as control.

Results: PAX6 and PAX6(5a) were expressed at equal levels in lens epithelium and fibers. Ninety-five times more PAX6 transcripts were detected in the epithelial cells than in the fibers. Adult human cornea and monkey retina expressed less PAX6/PAX6(5a) than lens epithelium but more than lens fibers. Correspondingly, 40 fold higher levels of TBP transcripts were detected in lens epithelium than fibers, suggesting reduced overall expression of transcription factors in the adult lens fibers.

Conclusions: The presence of PAX6 and PAX6(5a) messages and proteins in adult lens epithelium suggest functions for both forms of PAX6 in the growth and maintenance of the adult human lens. The reduced levels of both forms of PAX6 in the lens fibers suggest down regulation of this gene during differentiation of epithelia into fibers. The lower level of TBP expression in lens fibers also suggests reduced transcriptional competence of adult lens fibers.

Introduction

PAX6 is a critical regulatory gene located on human chromosome 11p13 and is expressed in many developing ocular tissues, brain, and pancreas [1]. PAX6 encodes a specific DNA-binding transcription factor capable of initiating lens [2] and eye [3] development. Heterozygous mutations in PAX6 induce a spectrum of ocular diseases including aniridia, Peters' anomaly, autosomal dominant keratitis, foveal hypoplasia, and early onset cataract [1]. Homozygous PAX6 mutations cause anophthalmia, severely damaged brain, and neonatal lethality [4]. Interestingly, a specific mutation in PAX6 may also be involved in subtle abnormalities of frontal lobe function [5]. Two major forms of the protein, PAX6 and PAX6(5a) (Figure 1A), result from alternate splicing [6]. Studies on the transcriptional regulation of crystallin genes in vertebrate lenses implicate PAX6 as an important regulatory factor [7,8]. The function of Pax-6(5a) has been less extensively studied; however, overexpression of PAX6(5a) relative to PAX6 was detected in human congenital cataract [4]. In addition, ectopic expression of PAX6(5a) in lens fiber cells of transgenic mice resulted in abnormal lens phenotype associated with changes in the levels of cell adhesion proteins [9].

Expression of PAX6 in adult ocular tissues has not been well documented and the levels of expression of PAX6 and PAX6(5a) mRNA and protein in adult lens has not been investigated. Since PAX6 is likely to play a major role in adult lens growth and maintenance we have characterized the levels of PAX6 and PAX6(5a) expression in the adult human lens using a highly sensitive competitive RT-PCR assay and we have monitored the corresponding protein by immunohistochemistry. We demonstrate that PAX6 and PAX6(5a) are highly expressed at equal ratios in the adult lens epithelium, retina, and cornea. Correspondingly, the levels of PAX6 and PAX6(5a) were 95 times less abundant between lens epithelium and lens fibers. Similarly, TBP/TFIID expression also declined between lens epithelia and lens fibers. The present data confirm greater transcriptional competence of lens epithelium relative to lens fibers and provide the basis for understanding the role of PAX6 and PAX6(5a) in adult lens maintenance.

Methods

Preparation of RNA

Whole normal human lenses were obtained from an eye bank and microdissected into epithelia and fiber cells as previously described [10]. Lens epithelial and corneal RNA preparations were prepared using the RNeasy kit as specified by the manufacturer (Qiagen, Valencia, CA). Whole lens and fiber RNAs were prepared using TRIZOL reagent as specified by the manufacturer (Life Technologies, Inc., Gaithersburg, MD). Monkey macula RNA was a gift from Dr. Ignacio Rodriguez (National Eye Institute, Bethesda, MD) and was used in lieu of human tissue to avoid potential RNA degradation that is common in human retinal RNA preparations.

Cloning of human PAX6, PAX6(5a), and TBP partial cDNAs

Reverse transcription-polymerase chain reaction (RT-PCR) was employed using a One-step Superscript II RT-PCR kit (Life Technologies, Inc., Gaithersburg, MD) to generate PAX6/PAX6(5a) and TBP products, using total RNA prepared from human lens epithelial cell line B3 [11]. The PAX6 and TBP sequences were obtained from Genbank under accession numbers M93650 and M34960, respectively. Oligonucleotides used for PAX6/PAX6(5a) (AGCTATCGATGGCAGAAGATTGTAGAG and CGGGATCCGATGACACGCTTGGTATG) and TBP (CGGGATCCTTCCACTCACAGACTCTCAC and CGGAATTCGCTCTCTTATCCTCATGATTACC) amplification, were extended with non-complementary sequences (blue) with restriction sites ClaI, BamHI, and EcoRI (red) and subcloned as a ClaI-BamHI (PAX6) and a BamHI-EcoRI (TBP) fragments into a pBluescript SK II (Stratagene, LaJolla, CA). The PCR products were purified in 1% agarose gels, specific bands were isolated from the gel using the GFX system (Amersham-Pharmacia, Piscataway, NJ), the resulting fragments were digested with appropriate enzymes, and ligated into a pBluescript KS II. The resulting clones were verified by sequencing at the Albert Einstein College of Medicine DNA Sequencing Core Facility (AECOM).

Design of PCR Mimics

PAX6 and PAX6(5a) transcripts were monitored in the presence or absence of internal quantification standards called PCR mimics [12]. These mimics are plasmid DNAs containing the PAX6 or PAX6(5a) cDNA sequences with an insertion of three copies of a synthetic double stranded oligonucleotide at a unique PstI site of PAX6 or PAX6(5a) partial cDNAs as described above and therefore contain identical coding sequence and primer binding sites as unmodified PAX6 or PAX6(5a) cDNA. A diagrammatic summary of the PCR mimics is shown in Figure 1B.

Competitive Reverse Transcriptase-PCR

Indicated transcripts were reverse-transcribed and amplified using the One Step RT-PCR system (Life Technologies, Inc.) in the presence or absence of PCR mimics as internal standards. Where indicated, control reactions were performed identically in the absence of reverse transcriptase. The initial reverse transcriptase step was conducted at 50 °C for 30 min followed by 30 PCR cycles at annealing temperature of 55 °C. All primers used in this study were designed to cross intron-exon boundaries and were tested in the absence of reverse transcriptase. Control reactions were performed to ensure linearity of amplification over the concentrations of RNA in the present study. The sequences of the primers used for amplification of PAX6 and PAX6(5a) transcripts were 5'-CGGCAGAAGATTGTAGAG-3' and 5'-GATGACACGCTTGGTATG-3'. Where indicated, 0.13 pg of mimic DNA templates (0.65 pg each) were co-amplified with authentic PAX6 mRNA as internal standards. TBP was examined under identical conditions as a control. The sequences of the TBP primers were 5'-TTCCACTCACAGACTCTCAC-3' and 5'-GCTCTCTTATCCTCATGATTACC-3'. Where indicated, glyceraldehyde phosphate dehydrogenase (GAPDH) was also examined as a control using the primers 5'-TGTTCCAGTATGATTCCACCC-3' and 5'-TCCACCACCCTGTTGCTGTA-3'.

Results

Quantification of PAX6 and PAX6(5a) transcripts in human lens epithelia and fibers

The relative levels of PAX6 and PAX6(5a) transcripts were measured in adult human lens epithelia, lens fibers and whole lenses by competitive RT-PCR [13-15] using PAX6 and PAX6(5a) mimics (Figure 1) as internal quantification standard. The data is shown in Figure 2. Equal amounts of two bands corresponding to PAX6 and PAX6(5a) transcripts were detected in lens epithelia (Figure 2A, lane 7), lens fibers (Figure 2B, lane 7) and whole lens (Figure 2C, lane 7) in the absence of the mimics. Purification and sequencing of these bands confirmed the PAX6 and PAX6(5a) transcripts. As control, the DNA mimics were amplified in the absence of RNA (Figure 2A-C, lane 1). In competitive RT-PCR, the amount of RNA required to compete with a fixed amount of mimic DNA is a quantitative approximation of the amount of target transcript [13-15]. Equal levels of PAX6 and PAX6(5a) transcripts and mimic transcripts were detected at a ratio of 3 ng of epithelial RNA to 0.065 pg of each mimic DNA (Figure 2A, lane 4). Thus, the amount of PAX6 and PAX6(5a) transcript in lens epithelial total RNA is approximately 2.0 x 10^-2 pg transcript per ng of RNA. In contrast to the lens epithelium, equal levels of PAX6 and PAX6(5a) transcripts and mimic transcripts were not detected until at least 300 ng of lens fiber RNA was co-amplified with 0.065 pg of each mimic DNA (Figure 2B, lane 5). Based on these values we estimate that the amount of PAX6 and PAX6(5a) transcripts in lens fibers is approximately 2.1 x 10^-4 pg transcript per ng of RNA which is 95 times less than that detected in lens epithelia. Using whole lens RNA, equal levels of PAX6 and PAX6(5a) transcripts and mimic transcripts were detected at a ratio of 200 ng of total lens RNA to 0.065 pg of each mimic DNA (Figure 2B, lane 6). Thus, the amount of PAX6 and PAX6(5a) transcript in total lens RNA is approximately 3.2 x 10^-4 pg transcript per ng of RNA.

Relative levels of TBP in human lens epithelia and fibers

As a measure of the potential of PAX6 and PAX6(5a) to be transcriptionally active in lens epithelia or fibers, the level of TBP mRNA in each preparation was examined relative to GAPDH transcripts. Figure 3A shows the relative levels of TBP present in lens epithelial RNA. Significant amounts of TBP transcript were detected in as little as 5 ng of epithelial RNA (Figure 3A, lane 1). By contrast as much as 200 ng of lens fiber (Figure 3, lane 3) or whole lens (Figure 3B, lane 3) RNA was required to yield similar amounts of transcript. Shown as controls for each panel are the corresponding levels of GAPDH.

Quantification of PAX6 and PAX6(5a) transcripts in monkey macula and human cornea

The levels of PAX6 and PAX6(5a) transcripts were also measured in monkey macula and human cornea RNA preparations. Equal levels of PAX6 and PAX6(5a) transcripts and mimic transcripts were obtained using 5 ng of the macula RNA (Figure 4, lane 5) or 10 ng of the cornea RNA preparation using 0.065 pg of each mimic DNA. The amount of each transcript is 1.3 x 10^-2 pg transcript per ng of monkey macula RNA and 6.5 x 10^-3 pg of transcript per ng of human cornea RNA.

Discussion

In the present study, we have characterized the expression levels of PAX6 and PAX6(5a) mRNAs in the adult human lenses and compared the absolute levels of these transcripts in lens epithelium and fibers. We also characterized RNA levels of these transcripts in retina and cornea. Our data indicate that lens fibers express lower levels of PAX6 mRNA while human cornea and lens epithelium expressed about 20 times and 95 times more of these mRNAs, respectively. In addition, we found 40 fold more PAX6/PAX6(5a) transcripts in monkey retina over the human lens fibers. The data suggest that while lens fiber cells contain an overwhelming majority of mRNAs encoding crystallins they still express PAX6 mRNAs at appreciable levels. To gain insight into the transcriptional competence of PAX6/PAX6(5a) in lens epithelium and lens fibers, we examined the corresponding levels of TBP, a general transcription factor required for transcription of all structural genes [16]. TBP has been used as a standard for determination of absolute levels of genes expressed in a homogenous population of eukaryotic cells [17,18]. In the present study, we observed about 40 fold reduction of TBP mRNA in lens fiber cells relative to lens epithelium. Thus, we propose that lower expression of PAX6 in lens fibers compared to epithelium can be attributed to two factors, (1) reduced expression as a result of cellular differentiation and (2) a general decrease of expression of other transcription factors represented by TBP/TFIID. Our data provide the first quantification of regulatory mRNAs in adult human lenses, an important step towards the mapping of human lens transcriptosome using cDNA microarrays [18].

Expression of Pax-6/PAX6 in developing lens and eye has been previously examined both using radioactive in situ hybridizations and immunohistochemistry. These studies revealed Pax-6/PAX6 expression and nuclear localization in the lens epithelium while reduced staining was observed in the differentiating lens fibers not distinguishing the two major forms, Pax-6 and Pax-6(5a). In mouse, those studies focused on E12.5 to 15.5 [19-21], and in human, data are available only for 6 and 10 week old human eyes [22]. Later stages were not examined since the denucleation of lens fiber cells make similar studies difficult to conduct. Here, we also performed an immunostaining with a Pax6 specific monoclonal antibody [23] and frozen sections of lens obtained from a 16 year old female donor. As expected [22], PAX6 proteins were detected in the nuclei of lens epithelium but not in the differentiating fiber nuclei (data not shown). In addition, western analysis (data not shown) failed to detect PAX6 in lens extracts obtained from dissected human lenses. This was likely due to the amount of PAX6 below the detection limit of the assay in agreement with previous western analysis using chicken [24] and mouse [9] lenses.

We found equal amounts of PAX6 and PAX6(5a) mRNAs in the adult lens epithelia and fibers. This is in contrast to previous studies on Pax-6 expression in embryonic and neonatal lenses and cultured lens cells. These studies [25-27] detected higher levels of Pax-6 over the Pax-6(5a) in samples examined. Quantitative RNase protections demonstrated constitutive splicing of Pax-6 and Pax-6(5a) at ratio 8:1 throughout mouse embryogenesis and in the adult mouse brain [25]. Similar data were observed using RT-PCR analysis and western blots of Pax-6 expression in cultured mouse (aTN4) and rabbit (N/N1003A) lens epithelial cells [26]. By contrast, a study of bovine lens, retina, cornea, and iris revealed possible tissue-specific fluctuation of Pax6 and Pax6(5a) ratio with the highest level of Pax6(5a) expression in the iris while Pax6 form dominated in the lens [27]. Our data indicate that the adult human lens expresses appreciable high levels of PAX6 and PAX6(5a) mRNAs in lens epithelium but not fibers. Moreover, the levels of PAX6 and PAX6(5a) are also high in the retina and cornea. Surprisingly, the ratio of PAX6 and PAX6(5a) was found to be equal in all tissues examined. This is potentially an important observation since PAX6 and PAX6(5a) may regulate different sets of target genes [4,6,9,28] and earlier studies focused almost exclusively on the role of the presumably more abundant form, PAX6. Not surprisingly, corresponding levels of TBP/TFIID declined in lens fibers indicating a loss of transcriptional competence during the differentiation of lens epithelia into lens fibers. These studies provide the groundwork for future studies to determine the role of PAX6 and PAX6(5a) in adult human lens maintenance and cataract.

Acknowledgements

We thank Drs. Ronald M. Burde for his support, Usha P. Andley for B3 lens cells, and Ignacio Rodriguez for monkey macula RNA. Pax-6 monoclonal antibody was obtained from the Developmental Studies Hybridoma Bank (The University of Iowa, Dept. of Biological Sciences, Iowa City, IA) maintained under contract N01-HD-7-3263 from the NICHD. Supported by grants from NIH, EY12200 to A.C., and EY13022 to M.K., Resnick Gerontology Center, Human Genome Program and an unrestricted grant from RPB to the Department of Ophthalmology and Visual Sciences of the Albert Einstein College of Medicine. A.C. is a recipient of a Research to Prevent Blindness Inc. (RPB) Career Development Award.

References

1. Glaser T, Walton DS, Cai J, Epstein JA, Jepeal L, Maas RL. PAX6 gene mutations in aniridia. In: Wiggs JL, editor. Molecular genetics of ocular disease. New York: Wiley-Liss; 1995. p. 55-81.

2. Altmann CR, Chow RL, Lang RA, Hemmati-Brivanlou A. Lens induction by Pax-6 in Xenopus laevis. Dev Biol 1997; 185:119-23.

3. Chow RL, Altmann CR, Lang RA, Hemmati-Brivanlou A. Pax6 induces ectopic eyes in a vertebrate. Development 1999; 126:4213-22.

4. Glaser T, Jepeal L, Edwards JG, Young SR, Favor J, Maas RL. PAX6 gene dosage effect in a family with congenital cataracts, aniridia, anophthalmia and central nervous system defects. Nat Genet 1994; 7:463-71.

5. Heyman I, Frampton I, van Heyningen V, Hanson I, Teague P, Taylor A, Simonoff E. Psychiatric disorder and cognitive function in a family with an inherited novel mutation of the developmental control gene PAX6. Psychiatr Genet 1999; 9:85-90.

6. Epstein JA, Glaser T, Cai J, Jepeal L, Maas RL. Two independent and interactive DNA-binding subdomains of the Pax6 paired domain are regulated by alternative splicing. Genes Dev 1994; 8:2022-34.

7. Cvekl A, Piatigorsky J. Lens development and crystallin gene expression: many roles for Pax-6. Bioessays 1996; 18:621-30.

8. Kondoh H. Transcription factors for lens development assessed in vivo. Curr Opin Genet Dev 1999; 9:301-8.

9. Duncan MK, Kozmik Z, Cveklova K, Piatigorsky J, Cvekl A. Overexpression of PAX6(5a) in lens fiber cells results in cataract and upregulation of a5b1 integrin expression. J Cell Sci 2000; 113:3173-85.

10. Horwitz J, Dovrat A, Straatsma BR, Revilla PJ, Lightfoot DO. Glutathione reductase in human lens epithelium: FAD-induced in vitro activation. Curr Eye Res 1987; 6:1249-56.

11. Andley UP, Rhim JS, Chylack LT Jr, Fleming TP. Propagation and immortalization of human lens epithelial cells in culture. Invest Ophthalmol Vis Sci 1994; 35:3094-102.

12. Bhat SP, Rayner SA, Huang CM, Ariyasu RG. Quantitative estimation of RNA transcripts suggests persistence of Pax-6 expression in the postembryonic chick retina. Dev Neurosci 1999; 21:140-6.

13. Gilliland G, Perrin S, Blanchard K, Bunn HF. Analysis of cytokine mRNA and DNA: detection and quantitation by competitive polymerase chain reaction. Proc Natl Acad Sci U S A 1990; 87:2725-9.

14. Bouaboula M, Legoux P, Pessegue B, Delpech B, Dumont X, Piechaczyk M, Casellas P, Shire D. Standardization of mRNA titration using a polymerase chain reaction method involving co-amplification with a multispecific internal control. J Biol Chem 1992; 267:21830-8.

15. Diviacco S, Norio P, Zentilin L, Menzo S, Clementi M, Biamonti G, Riva S, Falaschi A, Giacca M. A novel procedure for quantitative polymerase chain reaction by coamplification of competitive templates. Gene 1992; 122:313-20.

16. Carey M, Smale ST. Transcriptional regulation in eukaryotes: concepts, strategies, and techniques. Cold Spring Harbor (NY): Cold Spring Harbor Laboratory Press, 2000.

17. Iyer V, Struhl K. Absolute mRNA levels and transcriptional initiation rates in Saccharomyces cerevisiae. Proc Natl Acad Sci U S A 1996; 93:5208-12.

18. Lockhart DJ, Winzeler EA. Genomics, gene expression and DNA arrays. Nature 2000; 405:827-36.

19. Walther C, Gruss P. Pax-6, a murine paired box gene, is expressed in the developing CNS. Development 1991; 113:1435-49.

20. Davis JA, Reed RR. Role of Olf-1 and Pax-6 transcription factors in neurodevelopment. J Neurosci 1996; 16:5082-94.

21. West-Mays JA, Zhang J, Nottoli T, Hagopian-Donaldson S, Libby D, Strissel KJ, Williams T. AP-2alpha transcription factor is required for early morphogenesis of the lens vesicle. Dev Biol 1999; 206:46-62.

22. Nishina S, Kohsaka S, Yamaguchi Y, Handa H, Kawakami A, Fujisawa H, Azuma N. PAX6 expression in the developing human eye. Br J Ophthalmol 1999; 83:723-7.

23. Ericson J, Rashbass P, Schedl A, Brenner-Morton S, Kawakami A, van Heyningen V, Jessell TM, Briscoe J. Pax6 controls progenitor cell identity and neuronal fate in response to graded Shh signaling. Cell 1997; 90:169-80.

24. Duncan MK, Cvekl A, Li X, Piatigorsky J. Truncated forms of Pax-6 disrupt lens morphology in transgenic mice. Invest Ophthalmol Vis Sci 2000; 41:464-73.

25. Kozmik Z, Czerny T, Busslinger M. Alternatively spliced insertions in the paired domain restrict the DNA sequence specificity of Pax6 and Pax8. EMBO J 1997; 16:6793-803.

26. Richardson J, Cvekl A, Wistow G. Pax-6 is essential for lens-specific expression of zeta-crystallin. Proc Natl Acad Sci U S A 1995; 92:4676-80.

27. Jaworski C, Sperbeck S, Graham C, Wistow G. Alternative splicing of Pax6 in bovine eye and evolutionary conservation of intron sequences. Biochem Biophys Res Commun 1997; 240:196-202.

28. Yamaguchi Y, Sawada J, Yamada M, Handa H, Azuma N. Autoregulation of Pax6 transcriptional activation by two distinct DNA-binding subdomains of the paired domain. Genes Cells 1997; 2:255-61.