Molecular Vision 2003; 9:179-183 <http://www.molvis.org/molvis/v9/a26/> Received 22 January 2003 | Accepted 30 April 2003 | Published 1 May 2003

Download Reprint

β-Amyloid secretases and β-amyloid degrading enzyme expression in lens

Guanghui Li, Luigi Percontino, Qian Sun, A. Sami Qazi, Peter H. Frederikse
 
 

Department of Pharmacology & Physiology and the Integrative Neuroscience Program, UMDNJ-New Jersey Medical School, NJ

Correspondence to: Peter H. Frederikse, Ph.D., UMDNJ-New Jersey Medical School, 185 South Orange Avenue, MSB H-645, Newark, NJ, 07103 Phone: (973) 972-1686; FAX: (973) 972-7950; email: frederph@umdnj.edu

Abstract

Purpose: β- and γ-Secretases are proteases involved in the processing of the Alzheimer precursor protein (AβPP) that releases the transmembrane β-amyloid fragment (Aβ), associated with age-dependent disease in lens and brain. γ-Secretase is a protein complex containing Presenilin and Nicastrin proteins, which also processes Notch and other receptors involved in the eye and lens development. Neprilysin (NEP), a major protease involved in degrading Aβ, acts with β- and γ-secretases to regulate steady-state levels of Aβ. Previously, we demonstrated AβPP and Presenilin expression and processing in the lens and demonstrated cell degeneration in classic Alzheimer disease (AD) transgenic and systemic oxidative stress animal models, suggesting that additional AβPP processing proteins are also present in the lens. Here we investigate lens expression of β-secretases, nicastrin and NEP proteins, and compare their protein distribution to Notch and Presenilin in lens.

Methods: RT-PCR was used to analyze mRNA transcripts. Immunoblots and immunohistochemistry were used to examine the protein expression and distribution of secretase and Aβ degrading proteins, as well as Presenilin and Notch proteins in mouse lenses.

Results: β-Acting cleaving enzymes, BACE (BACE1) and BACE2, Nicastrin, Presenilins, Notch and NEP are expressed in the lens. In situ examination of protein distribution in lens indicates expression of each of these proteins is upregulated in peripheral elongating fiber cells at the lens equatorial margin and overlaps with Notch and Presenilin proteins, and also with the distribution of AβPP and Aβ proteins demonstrated in a previous study. Neprilysin exon 1-4 splicing, previously described as diagnostic for neuronal expression, also occurs in lens.

Conclusions: BACE, BACE2, Nicastrin and NEP are expressed primarily in elongating peripheral fiber cells, overlapping with Notch, Presenilin, and AβPP protein distribution in lens, consistent with their role in regulating Notch and AβPP ectodomain shedding in lens. Lens expression of β- and γ-secretases together with NEP suggests these proteins may also regulate Aβ turnover in the lens. The presence of Aβ processing and degrading proteases in lens provides further evidence that Alzheimer-related cell biology is fundamentally involved in lens development, and provides additional evidence that mechanisms of Alzheimer pathophysiology can contribute to lens degeneration, suggesting further that therapeutics targeting Aβ proteases may be applicable to lens degenerative disease.

Introduction

Alzheimer precursor protein (AβPP) is a transmembrane protein present in vesicle and cell surface membranes, that is proteolytically processed, releasing β-amyloid (Aβ) peptides [1,2]. AβPP has been linked with the major age-dependent diseases of brain and lens in Alzheimer transgenic mouse models [2-4]. γ-Secretase is a protein complex that includes Presenilin and nicastrin proteins. γ-Secretase cleaves AβPP at the C-terminus of the transmembrane Aβ peptide [5-12]. The β-secretases include β-acting cleaving enzymes BACE (BACE1) and BACE2, which cleave AβPP at the N-terminal end of Aβ [13,14]. Aβ monomers or small oligomers are thought to contribute to age-dependent disease by producing oxidative stress, in part due to metal binding [15]. In the lens, Aβ is toxic to cultured lens cells and is also present in cataractous human lenses [4]. In contrast, the role of Aβ in normal cell physiology is not well understood.

Previously, we demonstrated Presenilin 1 and Presenilin 2 (PS 1 and 2) expression and processing in lens, similar to PS processing in neurons [5], and also demonstrated lens expression of AβPP and Aβ [3,4]. PS proteins are multi-pass membrane proteins in vesicle membranes and at the cell surface that provide the proteolytic active site for the γ-secretase complex [10-12]. In Alzheimer neurodegenerative disease, PS gene mutations are the largest contributors to early-onset familial forms of the disease [2]. PS proteins are obligately co-expressed with Notch proteins in Drosophila, C. elegans, and mammalian tissues [7,8,10]. In addition, the γ-secretase complex requires nicastrin for proper activity [11,12]. γ-Secretase also processes a variety of other receptors including Notch and the tyrosine kinase receptor ErbB4, also present in vesicle membranes, in a process termed ectodomain shedding [9-12]. Once released, the cytoplasmic AβPP, Notch, and ErbB4 domains travel to the cell nucleus to globally regulate gene expression [7-9,16]. Although Alzheimer's disease therapeutics involving γ-secretase protease inhibitors have much promise, the pleiotropic nature of ectodomain shedding now appears to challenge the possible efficacy of γ-secretase inhibitors to regulate Aβ levels.

The β-site AβPP cleaving enzymes, BACE and BACE2, are β-secretase glycoproteins that cleave AβPP at the N-terminal end of Aβ [13,14,17]. This cleavage event is thought to occur at the interior surface of vesicle membranes, or at the cell surface [1]. Like the AβPP gene, the BACE2 gene is located within the Down Syndrome (DS) critical region of human chromosome 21 and mouse chromosome 16 [17]. BACE protease inhibitors are also under investigation as potential β-amyloid disease therapeutic agents.

Neprilysin (NEP) was identified as a primary Aβ degrading enzyme [18-21]. However, NEP was first identified some time ago as Common Acute Lymphoblastic Leukemia Antigen 10 (CALLA10; CD10). Similar to Alzheimer's disease and cataract, Acute Lymphoblastic Leukemia (ALL) also occurs at high rates in Down's syndrome and, in addition, somatic trisomy 21 is also associated with ALL [3].

In the present study we demonstrate BACE and BACE2, Nicastrin, Notch, and NEP expression in mouse and rat lenses, at the transcript and protein level. Further, each of these proteins is expressed in differentiating mouse lens fibers that also express Notch and AβPP in mammalian lenses, consistent with their required roles in AβPP and Notch ectodomain shedding. Finally, we identified exon 1-4 Neprilysin splicing in lens that previously was considered diagnostic of its expression in neurons [19-21]. The present data demonstrate key AβPP and Notch regulatory proteases, and Aβ degrading enzymes in lens that contribute to normal lens cell biology and possibly also to lens Alzheimer pathophysiology.

Methods

RT-PCR

C57/Bl6 mice and Sprague Dawley rats were used according to procedures prescribed by the US Public Health Service Policy on humane care and use of laboratory animals. Total lens RNA was purified from mouse and rat lenses using Trizol reagent (Invitrogen, Carlsbad, CA). cDNA was produced using random hexamer primers and reverse transcriptase (Invitrogen). The corresponding cDNAs were amplified in PCR reactions [3] using the following primers that correspond to sequences in neighboring exons: Mouse BACE: GTATAGCGAGTGGTCGAT, TGTGCCCTACACCCAG; Rat BACE: ATTGGTGGTATCGACCATTC, GCCTGTGGATGACTGTGAGA; BACE2: GAAGCAGTAACTTCGCTGT, CAAGACTACCTCCGTTGGT; Neprilysin GCGGAGATGTGCAAGTGG, ATCGGGAACTGGTCTC; Nicastrin: CGACTTACGTTGTGCAG, TGGATGTCTTTCCAGCG; Rat/Mouse Notch 1: CCTCTCCACCAATACCTG, GATGCCCTCGGACCAATCA. Nucleotide sequences were determined for all amplified products to confirm their identities. DNA contamination was also controlled for in PCR reactions where RT was omitted in the preparation of cDNAs, and no products were observed.

Western blot and immunohistochemistry

Lenses were placed in B-per extraction buffer (Pierce, Rockford, IL), and briefly sonicated on ice. Proteins were resolved by SDS-PAGE, blotted onto filter paper, and probed with anti-BACE and anti-BACE2 antibodies, (Calbiochem, San Diego, CA and Santa Cruz Biotechnology Santa Cruz, CA) to detect proteins on immunoblots [3,4]. Protein bands present on membrane filters were visualized using VIP staining kits (Vector Labs, Burlingame, CA).

For in situ immunohistochemical detection of protein in lenses [4], paraffin sections of whole mouse eyes were probed with anti-BACE, BACE2, Nicastrin, Notch or Presenilin antibodies (Santa Cruz Biotechnology), or with anti-NEP (Sigma, St. Louis, MO). Histological sections were deparaffinized in xylene, hydrated in graded alcohol washes, and then placed in antigen unmasking solution (Vector labs) for 20 min at 60 °C. Slides were first blocked in 2% horse serum (Vector labs) in PBS pH 7.4 for 2 h, and next incubated in antibodies diluted 1:200 in PBS with 2% horse serum. Immune complexes were visualized with fluor-conjugated secondary antibodies (Molecular Probes, OR), and viewed by fluorescence microscopy. Photomicrographs were obtained with a CCD camera.

Results

The amplified cDNA products in Figure 1 demonstrate BACE and BACE2 expression in mouse and rat lenses. BACE and BACE2 transcripts are the spliced products of nine exon open reading frames, and BACE oligonucleotide primers are complimentary to sequences in neighboring exons. BACE and BACE2 amplified products contained the appropriate sequences present in the Genbank database.

We also examined the expression of nicastrin and neprilysin transcripts in rodent lenses. RT-PCR products corresponding to NEP (Figure 1B) and Nicastrin (Figure 1C) were amplified from total rat and mouse lens RNA respectively. Neprilysin transcripts are alternatively spliced using one of three upstream non-coding exons. Previous investigators demonstrated exon 1 to 4 splicing occurs only in neurons [19,21]. Here, we also identify exon 1-4 splicing in rat lenses, however exon 2-4 splicing was not detected in our experiments. This finding adds to the number of neuron specific gene splicing and gene products related to Alzheimer cell biology observed in lens [3, and unpublished data].

In our previous study, we determined the expression and distribution of PS 1 and 2 in lens. Here, we determined lens expression of Notch in rat and mouse lenses by RT-PCR (Figure 1D). Similar to previous studies in C. elegans, Drosophila, and mammals, Notch is co-expressed in mouse lenses with Presenilins and nicastrin.

We next examined BACE and BACE2 protein expression in the lens with western blots. Figure 2 demonstrates the presence of BACE and BACE2 cross-reacting proteins of about 54 and 56 kDa on immunoblots. In addition, two higher MW cross-reacting protein bands were detected for both BACE and BACE2 proteins. These bands are consistent with glycosylation of these proteins in the lens, as demonstrated in other tissues [14].

To determine the spatial expression pattern for the protein products of these genes in the lens we probed mouse eye sections with antibodies raised against Neprilysin (CD10), Nicastrin, BACE, BACE2, Notch 1, and also PS proteins. Figure 3 demonstrates representative sections from three mice probed with these antibodies. No signal was obtained when the primary antibody was omitted. Anti-Presenilin antibodies confirmed the localization pattern we demonstrated in our earlier study [5]. The data demonstrate that the greatest expression of β- and γ-secretase proteins, together with NEP, Notch receptor protein, and AβPP [3,4] occurs in peripheral fibers that are in the process of cell differentiation and elongation, and not in anterior epithelial cells.

Discussion

The present study describes the expression of β- and γ-secretase and Aβ degrading proteins in lens. We determined BACE, BACE2, Nicastrin, and NEP expression, and compared their expression with PS and Notch 1 expression in mammalian lenses. These proteins process Notch and AβPP proteins that have key roles in fundamental aspects of lens development. Processed Notch intracellular domain (NICD) translocates to the nucleus to activate transcription of genes that regulate cell generation, differentiation, and cell survival and it was recently demonstrated that the processed intracellular domain of AβPP (AID) binds Numb and Numb-like proteins that are repressors of Notch activity [22]. In addition, AβPP has a key role in mechanisms of Alzheimer pathophysiology linked with Aβ production. Both β- and γ-secretase processing of AβPP releases Aβ and together with NEP that degrades Aβ, may also regulate Aβ steady state levels in the lens as well as in the nervous system. PS and Nicastrin are γ-secretase proteins involved in the ectodomain processing of Notch, AβPP, and other receptor proteins. The similar lens distribution pattern of these proteins in lens is consistent with γ-secretase regulation of Notch in lens as well [22-24]. In addition, the present demonstration of Exon 1-4 splicing of NEP transcripts in lens provides an additional example of gene regulation shared exclusively by lens and neurons.

In mice, Aβ turnover in brain is on the order of 3 h [25], highlighting the critical roles of β- and γ-secretase and NEP activity in determining Aβ levels in that tissue. The present data suggest that increased secretase activity or decreased NEP Aβ degradation activity in lenses may have similar effects, contributing to lens pathology that we demonstrated in Alzheimer transgenic mice [2] and systemic oxidative stress [26] models. In summary, the present data demonstrate lens expression of additional key components associated with regulatory mechanisms of AβPP and Notch proteins and Alzheimer pathophysiology, further supporting the hypothesis that this mechanism contributes to degenerative disease in lens as well as the brain.

Acknowledgements

This work was supported in part by National Institutes of Health Grant EY-12377 (to PHF).

References

1. Muller U, Kins S. APP on the move. Trends Mol Med 2002; 8:152-5.

2. Selkoe DJ. Alzheimer's disease is a synaptic failure. Science 2002; 298:789-91.

3. Frederikse PH, Ren XO. Lens defects and age-related fiber cell degeneration in a mouse model of increased AbetaPP gene dosage in Down syndrome. Am J Pathol 2002; 161:1985-90.

4. Frederikse PH, Garland D, Zigler JS Jr, Piatigorsky J. Oxidative stress increases production of beta-amyloid precursor protein and beta-amyloid (Abeta) in mammalian lenses, and Abeta has toxic effects on lens epithelial cells. J Biol Chem 1996; 271:10169-74.

5. Frederikse PH, Zigler JS Jr. Presenilin expression in the ocular lens. Curr Eye Res 1998; 17:947-52.

6. Mitsiadis TA, Gayet O, Zhang N, Carroll P. Expression of Deltex1 during mouse embryogenesis: comparison with Notch1, 2 and 3 expression. Mech Dev 2001; 109:399-403.

7. Artavanis-Tsakonas S, Rand MD, Lake RJ. Notch signaling: cell fate control and signal integration in development. Science 1999; 284:770-6.

8. Fortini ME. Notch and presenilin: a proteolytic mechanism emerges. Curr Opin Cell Biol 2001; 13:627-34.

9. Lee HJ, Jung KM, Huang YZ, Bennett LB, Lee JS, Mei L, Kim TW. Presenilin-dependent gamma-secretase-like intramembrane cleavage of ErbB4. J Biol Chem 2002; 277:6318-23.

10. Struhl G, Adachi A. Requirements for presenilin-dependent cleavage of notch and other transmembrane proteins. Mol Cell 2000; 6:625-36.

11. Okochi M, Steiner H, Fukumori A, Tanii H, Tomita T, Tanaka T, Iwatsubo T, Kudo T, Takeda M, Haass C. Presenilins mediate a dual intramembranous gamma-secretase cleavage of Notch-1. EMBO J 2002; 21:5408-16.

12. Wolfe MS. APP, Notch, and presenilin: molecular pieces in the puzzle of Alzheimer's disease. Int Immunopharmacol 2002; 2:1919-29.

13. Bodendorf U, Danner S, Fischer F, Stefani M, Sturchler-Pierrat C, Wiederhold KH, Staufenbiel M, Paganetti P. Expression of human beta-secretase in the mouse brain increases the steady-state level of beta-amyloid. J Neurochem 2002; 80:799-806.

14. Acquati F, Accarino M, Nucci C, Fumagalli P, Jovine L, Ottolenghi S, Taramelli R. The gene encoding DRAP (BACE2), a glycosylated transmembrane protein of the aspartic protease family, maps to the down critical region. FEBS Lett 2000; 468:59-64.

15. Bush AI. Metal complexing agents as therapies for Alzheimer's disease. Neurobiol Aging 2002; 23:1031-8.

16. Cao X, Sudhof TC. A transcriptionally [correction of transcriptively] active complex of APP with Fe65 and histone acetyltransferase Tip60 [published erratum appears in Science 2001; 293:1436]. Science 2001; 293:115-20.

17. Solans A, Estivill X, de La Luna S. A new aspartyl protease on 21q22.3, BACE2, is highly similar to Alzheimer's amyloid precursor protein beta-secretase. Cytogenet Cell Genet 2000; 89:177-84.

18. Hauss-Wegrzyniak B, Wenk GL. Beta-amyloid deposition in the brains of rats chronically infused with thiorphan or lipopolysaccharide: the role of ascorbic acid in the vehicle. Neurosci Lett 2002; 322:75-8.

19. Li C, Hersh LB. Characterization of the promoter region of the rat neprilysin gene. Arch Biochem Biophys 1998; 358:189-95.

20. Hama E, Shirotani K, Masumoto H, Sekine-Aizawa Y, Aizawa H, Saido TC. Clearance of extracellular and cell-associated amyloid beta peptide through viral expression of neprilysin in primary neurons. J Biochem (Tokyo) 2001; 130:721-6.

21. Iwata N, Tsubuki S, Takaki Y, Shirotani K, Lu B, Gerard NP, Gerard C, Hama E, Lee HJ, Saido TC. Metabolic regulation of brain Abeta by neprilysin. Science 2001; 292:1550-2.

22. Roncarati R, Sestan N, Scheinfeld MH, Berechid BE, Lopez PA, Meucci O, McGlade JC, Rakic P, D'Adamio L. The gamma-secretase-generated intracellular domain of beta-amyloid precursor protein binds Numb and inhibits Notch signaling. Proc Natl Acad Sci U S A 2002; 99:7102-7.

23. Hu Y, Ye Y, Fortini ME. Nicastrin is required for gamma-secretase cleavage of the Drosophila Notch receptor. Dev Cell 2002; 2:69-78.

24. Yu G, Nishimura M, Arawaka S, Levitan D, Zhang L, Tandon A, Song YQ, Rogaeva E, Chen F, Kawarai T, Supala A, Levesque L, Yu H, Yang DS, Holmes E, Milman P, Liang Y, Zhang DM, Xu DH, Sato C, Rogaev E, Smith M, Janus C, Zhang Y, Aebersold R, Farrer LS, Sorbi S, Bruni A, Fraser P, St George-Hyslop P. Nicastrin modulates presenilin-mediated notch/glp-1 signal transduction and betaAPP processing. Nature 2000; 407:48-54.

25. Dovey HF, John V, Anderson JP, Chen LZ, de Saint Andrieu P, Fang LY, Freedman SB, Folmer B, Goldbach E, Holsztynska EJ, Hu KL, Johnson-Wood KL, Kennedy SL, Kholodenko D, Knops JE, Latimer LH, Lee M, Liao Z, Lieberburg IM, Motter RN, Mutter LC, Nietz J, Quinn KP, Sacchi KL, Seubert PA, Shopp GM, Thorsett ED, Tung JS, Wu J, Yang S, Yin CT, Schenk DB, May PC, Altstiel LD, Bender MH, Boggs LN, Britton TC, Clemens JC, Czilli DL, Dieckman-McGinty DK, Droste JJ, Fuson KS, Gitter BD, Hyslop PA, Johnstone EM, Li WY, Little SP, Mabry TE, Miller FD, Audia JE. Functional gamma-secretase inhibitors reduce beta-amyloid peptide levels in brain. J Neurochem 2001; 76:173-81.

26. Frederikse PH, Farnsworth P, Zigler JS Jr. Thiamine deficiency in vivo produces fiber cell degeneration in mouse lenses. Biochem Biophys Res Commun 1999; 258:703-7.