Appendix 3. Sanger sequencing of the OTX2 gene detected the deletion c.485delC (p.Pro162G.Infs*24) in exon 5 of OTX2 in a
patient with early onset retinal dystrophy with atypical maculopathy.
To access the data, click or select the words “Appendix 3” Primers used for sequencing of Exon 5 of OTX2 are: F: agctgatctgcccatgtagg R: CTAAGGCCCTTCGTTTTTCC.