Table 1 of Shiels, Mol Vis 2008; 14:2042-2055.
Table 1. PCR primers for mutation-profiling of EPHA2.
| Primer | Location | Strand | Sequence (5′-3′) |
|---|---|---|---|
| Ex1F | Intron-1 | Antisense | gcgaccaagctgaaaccgcttatt |
| Ex1R | 5′-upstream | Sense | ggcatgaatgaacaggagtcggtt |
| Ex2F | Intron-2 | Antisense | cgtaccttcccacgcccatc |
| Ex2R | Intron-1 | Sense | ccagcctgctgtgtgccttc |
| Ex3F1 | Exon-3 | Antisense | ACGGCATGGTCCACACAGGT |
| Ex3R1 | Intron-2 | Sense | ccaggcacctgcccacacta |
| Ex3F2 | Intron-3 | Antisense | aaggaaactgatgtctgggaagga |
| Ex3R2 | Exon-3 | Sense | CCAGAAGCGCCTGTTCACCA |
| Ex4F | Exon-5 | Antisense | CAGACTCGGGCCAGCACTGT |
| Ex4R | Intron-3 | Sense | ttcctgggtgcccggtacat |
| Ex5F | Intron-5 | Antisense | gacactgtgcctttaaccacttgctc |
| Ex5R | Exon-4 | Sense | GCTTCTTCCGGGCACCTCAG |
| Ex6F | Intron-6 | Antisense | ctctgctgtgctgccttggg |
| Ex6R | Intron-5 | Sense | tgcctgctcgtaggcagctt |
| Ex7F | Intron-7 | Antisense | ccgccggtgaccgagaaag |
| Ex7R | Intron-6 | Sense | ggcgtccttggaagaggcag |
| Ex8F | Intron-8 | Antisense | gattcctgcctgcgtgtcca |
| Ex8R | Intron-7 | Sense | tggagccttcccaagtgcaa |
| Ex9/10F | Intron-10 | Antisense | accaccgctgcctcctca |
| Ex9/10R | Intron-8 | Sense | tgggccgcattctgagcac |
| Ex10/11F | Intron-11 | Antisense | cctctccacccagtgtgggc |
| Ex10/11R | Intron-9 | Sense | cccacagcctggtccaagtc |
| Ex12F | Exon-13 | Antisense | TGGTGGTGTAGGTGGCCTCG |
| Ex12R | Intron-11 | Sense | tacctctgcccactcctccg |
| Ex13F | Exon-14 | Antisense | CGTCGCTGGCAGAGGTGAAC |
| Ex13R | Exon-12 | Sense | CCCTGGACAAGTTCCTTCGGg |
| Ex14F | Intron-14 | Antisense | aactgtcctctgcccagccc |
| Ex14R | Exon-13 | Sense | CGAGGCCACCTACACCACCA |
| Ex15F | Intron-15 | Antisense | ctgggccatcgtgtccagtc |
| Ex15R | Intron-14 | Sense | gggcagctctgaaggttggg |
| Ex16F | Intron-16 | Antisense | tggcggagttctgcccttct |
| Ex16R | Intron-15 | Sense | gactgggcttccctgttgcc |
| Ex17F1 | Exon-17 | Antisense | agggaccgctttgggtctca |
| Ex17R1 | Intron-16 | Sense | ctctccctctctccctcccg |
| Ex17F2 | Exon-17 | Antisense | ccctgccacacacacacattc |
| Ex17R2 | Exon-17 | Sense | agtggcctccctgctgtgc |
| Ex17F3 | 3′-downstream | Antisense | gctcccagggttaagtgacgtg |
| Ex17R3 | Exon-17 | Sense | gcagactgtgaacttgactgggtga |
| T-alleleF | Exon-17 | Antisense | GCCGGGCAGCCGCACCCA |
| Ex17SF | Exon-17 | Antisense | ggaggccactctgtttcttcaagt |