Figure 7 of
Jablonski, Mol Vis 2005;
11:569-581.
Figure 7. Rs1h mutation in 44TNJ mice
The intronic mutation in Rs1h results in alternative splice products and short peptide transcripts. The designation of the intron/exon boundaries follows the data given by Gehrig et al. [18], which is in agreement with our sequencing data (Figure 5). These sequences are different from the predicted data given by the ENSEMBL version (checked on May 28, 2005). Exon sequences are given in uppercase letters, intron sequences in lower case letters. The T to C exchange in intron 2 is indicated by a green/red color flip and a vertical red bar; the bases of the new NlaIII restriction site in the mutant sequence are in red. The stop codons in the new 44TNJ transcripts are marked with hyphens. The premature stop in the protein sequence is highlighted in red.
Exon 1 intron 1 Exon 2 | intron 2 Exon 3 wt genomic DNA*: TTTGGCTATGAAGgtatgt...gctcagCCACATTGGGATTGTCATCGACAGAGgtatgttacagtaa...cttgcagGATGAGGGTGAG 44TNJ genomic DNA: TTTGGCTATGAAGgtatgt...gctcagCCACATTGGGATTGTCATCGACAGAGgcatgttacagtaa...cttgcagGATGAGGGTGAG ---- wt transcript: TTTGGCTATGAAG CCACATTGGGATTGTCATCGACAGAG GATGAGGGTGAG wt protein: F G Y E A T L G L S S T E D E G E 44TNJ transcript 1: TTTGGCTATGAAG CCACATTGGGATTGTCATCGACAGAGgcatgttaca GATGAGGGTGAG 44TNJ protein 1: F G Y E A T L G L S S T E A C Y R Stop 44TNJ transcript 2: TTTGGCTATGAAG GATGAGGGTGAG 44TNJ protein 2: F G Y E G Stop |