McKay, Mol Vis 2004; 10:682-687. Table 1.

Table 1 of McKay, Mol Vis 2004; 10:682-687.

Table 1. Primers and probes used

The nucleotide sequences and melting temperatures of the primers (FIBL-6 F mut and FIBL-6 A) and sensor (Sensor C) and anchor (FIBL-6 FL) probes employed (see Figure 1) are shown. The reference ID numbers may be used to identify specific probes for resynthesis by the manufacturer (Tib MolBiol; Berlin, Germany). The positions of fluorescein (FL) and LC Red 640 (LC) labels and the phosphorylated 3'-end (p) of the sensor probe are indicated.


                                             Reference
 Identifier             Sequence                ID         Tm
------------   ---------------------------   ---------   -------
FIBL-6 F mut   CAGCTTCAAGTGTATCTATCCAC        463599     51.7 °C
FIBL-6 A       ATGCTGTTGAGGTTGATAGTT          463600     50.7 °C
FIBL-6 FL      CAATCCAGCGCAAGATTTCCC-FL       463602     61.6 °C
Sensor C       LC-TCCCCTAATAAATGTCGTCCTG p    463603     56.2 °C

McKay, Mol Vis 2004; 10:682-687 <http://www.molvis.org/molvis/v10/a82/>