Table 1 of
Burdon, Mol Vis 2003;
9:710-714.
Table 1. PCR amplification of albinism genes
Primer sequences for PCR amplification of albinism genes were designed or taken from the literature as indicated. Exon 1 of Tyrosinase gene was amplified in three overlapping fragments. The optimal annealing temperature is given.
Primer sequence 5'-3' Size of PCR Annealing Gene Exons or reference product temperature ---------- ---------------------------- --------------------- ----------- ----------- Tyrosinase 1A,1B,2-5 [22] 52 1C [22] 65 Enhancer GGCAAGTGTAAGGCAAAATTC 315 58 TTTGAGACAGAACAGGCTTTG Promoter TACCTCTCATTTGCAAGGTCA 400 58 TCACAGATTTCTCTTTCCAGC P Gene 2,3,6,7,10,11,14,16-18,21,24 [21] 58 4,9 [21] 65 5 ATGGAAGTTACTCAAGGCTGC 217 60 TATACAGCCAAAGGCACACAG 8,12,13,19,25 [21] 56 15 [21] 60 20 [21] 50 TYRP1 1 (including promoter) CCAAATTAGTGCTTCTGGC 360 60 CTAATGGAGTTTTGGCACG 2-8 [23] 55 |