Table 1 of Burdon, Mol Vis 2003; 9:710-714.


Table 1. PCR amplification of albinism genes

Primer sequences for PCR amplification of albinism genes were designed or taken from the literature as indicated. Exon 1 of Tyrosinase gene was amplified in three overlapping fragments. The optimal annealing temperature is given.

                                            Primer sequence 5'-3'   Size of PCR    Annealing
   Gene                 Exons                   or reference          product     temperature
----------   ----------------------------   ---------------------   -----------   -----------
Tyrosinase   1A,1B,2-5                      [22]                                      52
             1C                             [22]                                      65
             Enhancer                       GGCAAGTGTAAGGCAAAATTC       315           58
                                            TTTGAGACAGAACAGGCTTTG
             Promoter                       TACCTCTCATTTGCAAGGTCA       400           58
                                            TCACAGATTTCTCTTTCCAGC
P Gene       2,3,6,7,10,11,14,16-18,21,24   [21]                                      58
             4,9                            [21]                                      65
             5                              ATGGAAGTTACTCAAGGCTGC       217           60
                                            TATACAGCCAAAGGCACACAG
             8,12,13,19,25                  [21]                                      56
             15                             [21]                                      60
             20                             [21]                                      50
TYRP1        1 (including promoter)         CCAAATTAGTGCTTCTGGC         360           60
                                            CTAATGGAGTTTTGGCACG
             2-8                            [23]                                      55

Burdon, Mol Vis 2003; 9:710-714 <http://www.molvis.org/molvis/v9/a84/>
©2003 Molecular Vision <http://www.molvis.org/molvis/>
ISSN 1090-0535