Figure 6 of
Morin, Mol Vis 2003;
9:449-459.
Figure 6. Nucleotide and deduced amino acid sequences of Pγ-rod cDNAs obtained from adult rat cerebellum and from the extracephalic moiety of E13 rat embryo
The 5'- and 3'-untranslated (UTR) regions are in lower case letters; the coding region is in upper case letters; the stop codon is labelled with an asterisk; the polyadenylation signal is in blue. The 5'-UTR corresponds to the transcript obtained from the extracephalic moiety of the rat embryo. The transcipt obtained from adult rat cerebellum starts at position 136. The previously described pineal transcript [16] starts at position 143. The 3'-UTR corresponds to the transcript of the rat embryo.
tgcccaacaccagcatcctgggcagtggtgtctccctcagggcccagcaatctgattagtgtaatgtcagag 72 aagagagtcataatccgctcaccaggagaaggataaattcctaggccagtgctctgctgatccagatccag 143 acgactggcacctgtggctccctgagatctgtccaacgcttgcctgcatgaggagtccagcccagcctgac 214 agagtccagaagctaagggtcactgcagtgtctctgccggcctcacc ATG AAC CTG GAG CCA CCC 279 M N L E P P 6 AAG AGT GAG ATT CGG TCA GCC ACA CGG GTG ATG GGA GGG CCG GTC ACC CCC AGG 333 K S E I R S A T R V M G G P V T P R 24 AAA GGA CCA CCT AAA TTT AAG CAG CGG CAA ACA AGG CAG TTC AAG AGC AAG CCC 387 K G P P K F K Q R Q T R Q F K S K P 42 CCC AAA AAA GGC GTG CAA GGG TTT GGG GAC GAT ATC CCT GGA ATG GAA GGC CTG 441 P K K G V Q G F G D D I P G M E G L 60 GGA ACA GAT ATA ACC GTC ATC TGG CCT TGG GAG GCC TTC AAC CAT CTA GAG CTG 495 G T D I T V I W P W E A F N H L E L 78 CAT GAG CTG GCC CAG TAT GGC ATC ATC tagtcagactccccctacgtgagtgagccctgtgg 557 H E L A Q Y G I I * 87 aagctacctgctgaagacccactctaccatctgtaaaccctgtccaggacccctgcccaagcttgagcctg 628 agtccctagactcccctggaacaacctcaggccctgacaccagattctgagagcctacagcctcccacagg 699 acaccccattgacctgaagtcactgagcagcagaaagaagggagtgggacacagccccacctcctgtcctt 770 cttgtggctgtaacgcagggttggactccccagtaatgtttcccctgaactgccttctgaggataaggaag 841 ttcctctgtcttgcagccgttccagatgggtgtcttggggtgggacactgtcctggggtgatgtggcaaga 912 gagactaagctaccccacccattataccaaccttcccaacatactcttgtcccttgtccctatttcgaaat 983 aaaattagctatgtccttgccaaaaaaaaaaaaaaaaaaaaaaaaagcggccgctgaattctagaa 1049 |