Table 1 of
Wordinger, Mol Vis 2003;
9:249-256.
Table 1. PCR Primer Pairs
The table describes the expected sizes ("Size") of PCR amplification products with each human gene primer pair and the optimal annealing temperature. Primers were designed using Oligo 5.0 (National Biosciences, Plymouth, MN).
GenBank Anneal accession Upstream Primer Downstream Primer Size Temp. Gene number (5'->3') (5'->3') (bp) (°C) ------- --------- ----------------------- ---------------------- ---- ------ GDNF NM000514 CAGAGGGAATGGTCGCAGAGG TGGAGCCAGGGTCAGATACAT 339 55.9 Ret M57464 AGAGGAGCCAGGGTCGGATTC CATGCCATAGAGTTTGTTTTC 473 55.5 GFRα-1 U95847 AGACCATCGTGCCTGTGTGCT GGTCATGACTGTGCCAATAAG 215 54.4 β-actin NM001101 AGGCCAACCGCGAGAAGATGACC GAAGTCCAGGGCGACGTAGCAC 350 55.0 |