Table 1 of
Mukhopadhyay, Mol Vis 2002;
8:442-448.
Table 1. Mutation screening by allele specific restriction digestion
A small region of genomic DNA from test samples encompassing the location of suspected mutation was amplified by PCR and digested with restriction site that is lost or gained as a result of mutation as indicated and the digested DNA fragments were separated by electrophoresis in a 6% polyacrylamide gel as described in Materials and Methods.
Nucleotide Amino acid Sequence of primer pairs Length of PCR Gain (+) or loss (-) Digestion
change change Location (5' to 3') and PCR condition product (bp) of restriction site product (bp)
---------- ---------- -------- ---------------------------- ------------- -------------------- ------------
144 G->T Gln48His Exon 1 CTTCTGTGCACGTTGCTGCA 313 Acc I (-) 176+137
CTGGTCCAAGGTCAATTGGT
94 °C 30 s, 52 °C 30 s,
72 °C 60 s for 30 cycles
using 1 mM MgCl2
1109 C->T Pro370Leu Exon 3 ATACTGCCTAGGCCACTGGA 198 Alw N I (+) 159+39
CAATGTCCGTGTAGCCACC
94 °C 30 s, 58 °C 30 s,
72 °C 60 s for 35 cycles
using 1 mM MgCl2
|