Figure 1 of Wistow, Mol Vis 2002; 8:205-220.


Figure 1. Gene structure and alternative splicing for oculoglycan/opticin (Optc)

The cDNA sequence of Optc is shown mapped onto the human gene sequence taken from from the public version of the human genome. Intron sequence and intron gap lengths are shown in red. cDNA/exon sequence is shown in black. Coding sequence is shown in upper case and noncoding is lower case. The sequence that is deleted by alternative splicing is also in green, with the embedded SLRP class III signature enclosed in brackets. Leucine rich repeats are shown in blue. 5' and 3' flanking DNA sequences, possibly including additional 5' UTR, are shown in purple.

actgtctaacccaagccccagttcagacagcctccaccagagtccccacctttctggaag       Ex1
ctgcagggctctccatccaggatccagaagcattgaaggggtaaggctcaaggttgaggc       Int1
...(1756 bp)...gatcgctgcccttcctcgtgcccacttgccaggaccagccgctga       Ex2
                             M  R  L  L  A  F  L  S  L  L  A   11
agggattctcagtcccatctgactccccATGAGGCTCCTGGCTTTCCTGAGTCTGCTGGC
  L  V  L  Q  E  T  G  T  A  S  L  P  R  K  E  R  K  R  R  E   31
CTTGGTGCTGCAGGAGACAGGGACAGCTTCTCTCCCAAGGAAGGAGAGGAAGAGGAGAGA
  E  Q  M  P  R  E  G  D  S  F  E  V  L  P  L  R  N  D  V  L   51
GGAGCAGATGCCCAGGGAAGGCGATTCCTTTGAAGTTCTGCCTCTGCGGAATGATGTCCT
  N  P  D  N  Y  G  E  V  I  D  L  S  N  Y  E  E  L  T  D  Y   71
GAACCCAGACAACTATGGTGAAGTCATTGACCTGAGCAACTATGAGGAGCTCACAGATTA
  G  D  Q  L  P  E                                             77
TGGGGACCAACTCCCCGAGgtgagggacacagcagaccaactacattccctgcatgacac       Int2
                                        V  K  V  T  S  L  A    84
...(734 bp)...tgtgtactctgtgctacatctccagGTTAAGGTGACTAGCCTCGCT       Ex3
 P  A  T  S  I  S  P  A  K  S  T  T  A  P  G  T  P  S  S  N   104
CCTGCAACCAGCATCAGTCCCGCCAAGAGCACTACGGCTCCAGGGACACCCTCGTCAAAC
 P  T  M  T  R  P  T  T  A  G  L  L  L  S  S  Q  P  N  H      123
CCCACGATGACCAGACCTACTACAGCAGGGCTGCTACTGAGTTCCCAGCCCAACCATGgt       Int3
                     ...(1620 bp)...
   G  L  P  T [C  L  V  C  V  C  L  G  S  S  V  Y  C] D  D    142
cagGTCTGCCCACCTGCCTGGTCTGCGTGTGCCTCGGTTCCTCTGTGTATTGCGATGACA       Ex4
I  D  L  E  D  I  P  P  L  P  R  R  T  A  Y  L  Y  A  R  F    162
TTGACCTAGAGGACATTCCTCCTCTTCCTCGGAGGACTGCCTACCTGTATGCACGCTTCA
N  R  I  S  R  I  R  A  E  D  F  K  G  L                      176
ACCGCATCAGCCGTATCAGGGCCGAAGACTTCAAAGGGCTGAgtat...(854 bp)...       Int4
           T  K  L  K  R  I  D  L  S  N  N  L  I  S  S  I  D  193
acctctctcagCAAAGTTGAAGAGGATTGACCTCTCCAACAACCTCATTTCCTCCATCGA       Ex5
  N  D  A  F  R  L  L  H  A  L  Q  D  L  I  L  P  E  N  Q  L  213
TAATGATGCCTTCCGCCTGCTACATGCCCTCCAGGACCTCATCCTCCCAGAGAACCAGTT
  E  A  L  P  V  L  P  S  G  I  E  F  L  D  V  R  L  N  R  L  233
GGAAGCTCTGCCCGTGCTGCCCAGTGGCATTGAGTTCCTGGATGTCCGCCTAAATCGGCT
  Q  S  S  G  I  Q  P  A  A  F  R                             244
CCAGAGCTCGGGGATACAGCCTGCAGCCTTCAGGgtgagtcaag...(>2500 bp)...       Int5
                                        A  M  E  K  L  Q  F   251
ggacccaccagcctcctacactctttgctttctccacagGCAATGGAGAAGCTGCAGTTC       Ex6
 L  Y  L  S  D  N  L  L  D  S  I  P  G  P  L  P  L  S  L  R   271
CTTTACCTGTCAGACAACCTGCTGGATTCTATCCCGGGGCCTTTGCCCCTGAGCCTGCGC
 S  V  H  L  Q                                                276
TCTGTACACCTGCAGgtaaggagcaccacccagagcaagggtgata...(554 bp)...       Int6
                N  N  L  I  E  T  M  Q  R  D  V  F  C  D  P   291
atgtgttcttcccagAATAACCTGATAGAGACCATGCAGAGAGACGTCTTCTGTGACCCC       Ex7
 E  E  H  K  H  T  R  R  Q  L  E  D  I  R  L  D  G  N  P  I   311
GAGGAGCACAAACACACCCGCAGGCAGCTGGAAGACATCCGCCTGGATGGCAACCCCATC
 N  L  S  L  F  P  S  A  Y  F  C  L  P  R  L  P  I  G  R  F   331
AACCTCAGCCTCTTCCCCAGCGCCTACTTCTGCCTGCCTCGGCTCCCCATCGGCCGCTTC
 T  *                                                         332
ACGtagctcggagcccttccactcctcccaggtaagaaccctcca...(4935 bp)...       Int7
tctctctcaaggtcatctcttggaccagcgggcatcacattctccagcagccgccatctc       Ex8
acacgcctccctcctgtggccgccggcagcatggacaaaggtctccatgcagggggagga
ggcctgcttctttccccacagctctcacgtctcccttctccctgcgggtgacaaagaagc
ccaaggaccacctccttcctgcctcattgtaataaaattccccacactgaggccttcttg
tcttcaacctggcctgtccagcccttccagatatggccaaacccatggcctggatgggct

Wistow, Mol Vis 2002; 8:205-220 <http://www.molvis.org/molvis/v8/a27/>
©2002 Molecular Vision <http://www.molvis.org/molvis/>
ISSN 1090-0535