Figure 4 of
Wistow, Mol Vis 2002;
8:196-204.
Figure 4. Alternative splicing in PDE6G
The complete sequence of PDE6G deduced from hd/he retina ESTs is shown, colored according to exons in the human genome. Exon 1 is in red, exon 2 in blue, exon 3 in purple, and exon 4 in black. Sequence in lower case is noncoding, upper case is coding. Protein sequence is shown above the DNA sequence. In three ESTs, exon 2 is entirely skipped. The resulting shortened ORF is indicated by the green and brown protein sequence and the start sites of the canonical (1) and short (2) ORFs are indicated with arrows. The brown protein sequence shows the three α-helices involved in α-transducin binding. The polyadenylation site is shown in turquoise.
ggccggggctggcaccctgcggagggaggcccagcactcacagcacagcc 50
ccctgagacccgccctgcacttgaccgcagcaggagggagtccaggagcc 100
->1
M N L E P P 6
aaggttgccgcggtgtctccgtcagcctcaccATGAACCTGGAACCGCCC 150
K A E F R S A T R V A G G P V T P 23
AAGGCTGAGTTCCGGTCAGCCACCAGGGTGGCCGGGGGACCTGTCACCCC 200
R K G P P K F K Q R Q T R Q F K 39
CAGGAAAGGGCCCCCTAAATTTAAGCAGCGACAGACCAGGCAGTTCAAGA 250
S K P P K K G V Q G F G D D I P G 56
GCAAGCCCCCAAAGAAAGGCGTTCAAGGGTTTGGGGACGACATCCCTGGA 300
->2
M E G L G T D I T V I C P W E A F 73
ATGGAAGGCCTGGGAACAGACATCACAGTCATCTGCCCTTGGGAGGCCTT 350
N H L E L H E L A Q Y G I I * 87
CAACCACCTGGAGCTGCACGAGCTGGCCCAATATGGCATCATCTAGcacg 400
aggccctgctgaagtccagaccctccccctcctgcccactatgctctaaa 450
ccctgctcaggattcctgttgaggagatgcctccctagcccagatggcac 500
ctggacaccaggatgggactgcaacctcaggtctccccctacatattaat 550
accagtcaccaggagcccaccacctccctctaggatgccccctcaggggc 600
tggccaggccctgctcaacatctggagacacaggcccacccctcagtcct 650
gcccacagagaggcttggtcggtctccactcccagggagaacgggaagtg 700
gaccccagcccgggagcctgctggaccccagatcgtcccctcctcccagc 750
tggaaagctagggcaggtctccccagagtgcttctgcaccccagccccct 800
gtcctgcctgtaaggggatacagagaagctccccgtctctgcatcccttc 850
ccaggggggtgcccttagtttggacatgctgggtagcaggactccagggc 900
gtgcacggtgagcagatgaggccccaagctcatcacaccagggggccatc 950
cttctcaatacagcccgcccttgcagtccctatttcaaaataaaattagt 1000
gtgtccttg(polyA) 1009
|