Figure 3 of Wistow, Mol Vis 2002; 8:171-184.


Figure 3. Lengsin: cDNA sequence and predicted protein sequence

Sequences in red match PFAM profiles for glutamine synthetases. Sequences in green match the Gribskov (Z score) profile for the Class I glutamine synthetase adenylation site region. Residues overlapping between red and green are shown in blue.

                                   M  N  N  E  E  D  L  L  Q  E  D  S  12
gtggtttctaacgctgaacttaaaaagtgttgagATGAATAATGAAGAGGACCTTCTGCAGGAGGACTCA   70
 T  R  D  E  G  N  E  T  E  A  N  S  M  N  T  L  R  R  T  R  K  K  V   35
ACAAGAGATGAAGGCAATGAGACTGAAGCCAACAGCATGAACACATTAAGAAGGACAAGGAAGAAAGTC   140
T  K  P  Y  V  C  S  T  E  V  G  E  T  D  M  S  N  S  N  D  C  M  R  D 59
CTAAACCATATGTTTGTTCAACTGAAGTGGGAGAAACGGATATGTCCAATTCAAATGATTGCATGAGGGA  210
  S  S  Q  I  L  T  P  P  Q  L  S  S  R  M  K  H  I  R  Q  A  M  A  K  82
CAGCAGTCAAATTTTGACCCCACCTCAACTCTCTTCTAGAATGAAACACATTAGACAAGCCATGGCCAAA  280
 N  R  L  Q  F  V  R  F  E  A  T  D  L  H  G  V  S  R  S  K  T  I  P   105
AATCGCCTCCAGTTTGTACGATTTGAAGCAACAGACCTCCACGGCGTGTCCAGGTCTAAGACTATCCCTG  350
A  H  F  F  Q  E  K  V  S  H  G  V  C  M  P  R  G  Y  L  E  V  I  P  N 129
CACACTTTTTTCAAGAGAAAGTGAGCCATGGTGTTTGCATGCCCCGAGGTTATCTTGAAGTGATACCAAA  420
  P  K  D  N  E  M  N  N  I  R  A  T  C  F  N  S  D  I  V  L  M  P  E  152
TCCAAAGGACAATGAAATGAATAACATAAGAGCCACATGTTTTAATAGCGACATAGTCCTAATGCCAGAG  490
 L  S  T  F  R  V  L  P  W  A  D  R  T  A  R  V  I  C  D  T  F  T  V   175
TTATCAACCTTTAGAGTTTTGCCATGGGCTGACAGAACTGCAAGAGTGATATGTGATACCTTCACTGTGA  560
T  G  E  P  L  L  T  S  P  R  Y  I  A  K  R  Q  L  S  H  L  Q  A  S  G 199
CTGGTGAGCCTCTTTTGACTTCCCCAAGGTACATTGCAAAGAGGCAGCTGAGCCATCTGCAGGCCTCTGG  630
  F  S  L  L  S  A  F  I  Y  D  F  C  I  F  G  V  P  E  I  L  N  S  K  222
CTTTTCCCTGCTTTCTGCTTTCATCTATGATTTTTGCATTTTTGGTGTGCCCGAAATTTTAAATTCAAAG  700
 I  I  S  F  P  A  L  T  F  L  N  N  H  D  Q  P  F  M  Q  E  L  V  D   245
ATTATATCTTTTCCTGCTTTAACATTTTTAAATAACCATGATCAGCCCTTCATGCAGGAACTTGTTGATG  770
G  L  Y  H  T  G  A  N  V  E  S  F  S  S  S  T  R  P  G  Q  M  E  I  S 269
GCTTGTATCACACTGGAGCCAATGTCGAGAGTTTTTCCTCCTCTACCAGGCCTGGTCAGATGGAAATCTC  840
  F  L  P  E  F  G  I  S  S  A  D  N  A  F  T  L  R  T  G  V  K  E  V  292
TTTCCTGCCTGAATTTGGCATTAGCTCAGCTGATAATGCATTTACCCTCAGAACAGGTGTCAAAGAAGTG  910
 A  R  K  Y  N  Y  I  A  S  F  F  I  E  T  G  F  C  D  S  G  I  L  S   315
GCAAGGAAATATAATTACATTGCCAGCTTCTTCATTGAGACTGGATTTTGTGATTCAGGGATTTTGTCTC  980
H  S  L  W  D  V  D  R  K  K  N  M  F  C  S  T  S  G  T  E  Q  L  T  I 339
ATAGTCTCTGGGATGTCGATAGGAAGAAAAACATGTTCTGCAGCACTTCTGGAACTGAGCAGCTCACGAT 1050
  T  G  K  K  W  L  A  G  L  L  K  H  S  A  A  L  S  C  L  M  A  P  S  362
CACTGGGAAAAAATGGTTGGCAGGACTCTTGAAGCACTCTGCTGCGCTCAGCTGCCTGATGGCGCCTTCT 1120
 V  S  C  R  K  R  Y  S  K  D  R  K  D  L  K  K  S  V  P  T  T  W  G   385
GTTAGCTGCCGAAAGCGTTATTCCAAGGACAGGAAAGACCTGAAGAAGAGTGTGCCTACAACATGGGGAT 1190
Y  N  D  N  S  C  I  F  N  I  K  C  H  G  E  K  G  T  R  I  E  N  K  L 409
ACAATGACAACAGCTGTATATTTAATATCAAATGTCATGGAGAGAAAGGCACCCGGATAGAAAATAAACT 1260
  G  S  A  T  A  N  P  Y  L  V  L  A  A  T  V  A  A  G  L  D  G  L  H  432
AGGCTCAGCAACAGCAAACCCTTACTTGGTGCTGGCTGCAACTGTTGCTGCCGGCTTAGATGGACTTCAT 1330
 S  S  N  E  V  L  A  G  P  D  E  S  T  D  F  Y  Q  V  E  P  S  E  I   455
AGCAGTAATGAGGTCTTGGCTGGTCCAGATGAGAGCACAGACTTTTACCAAGTGGAACCTTCTGAGATCC 1400
P  L  K  L  E  D  A  L  V  A  L  E  E  D  Q  C  Q  R  Q  A  L  G  E  T 479
CTTTAAAACTAGAAGATGCCCTTGTGGCACTGGAAGAAGATCAATGCCAGAGACAGGCTCTAGGAGAAAC 1470
  F  I  R  Y  F  V  A  M  K  K  Y  E  L  E  N  E  E  I  A  A  E  R  N  502
CTTTATTCGATATTTTGTTGCCATGAAGAAATATGAGTTGGAGAATGAAGAAATAGCTGCAGAGAGAAAT 1540
 K  F  L  E  Y  F  I  *                                                509
AAATTCTTAGAGTATTTTATTTAGAATAGAGCTCACAACTACTCCTTTAGACATGTAATTGTTACTTAAA 1610
GCTAATCTACCAAAACAAAAAGACTGAACTTTTGTAATTAACAACAGCAACAATAACAAGATTACGAATG 1680
CTTTTGACTTTTTTTTTTGTCCATGGAATATTTGACAGATGAAGTAGGACTGCTGAGAAGATTCTGATAA 1750
CAGAAACAAACAACAAAGTTGTGGTGAAGCTATAATATGCAAACTTACCAGATCTTGTCAGTCATTTCCT 1820
ATGTGTATGTTGACCTGGATAAGAATATCCAATTTTGGGTGGCAATAAATATATTCGCACATTAAGAAAA 1890
AAAAGACTTAAGCATTAGAAAGCAAAATTTAAATGACTAAAAAAAAAAAAAAAAAAA              1947

Wistow, Mol Vis 2002; 8:171-184 <http://www.molvis.org/molvis/v8/a24/>
©2002 Molecular Vision <http://www.molvis.org/molvis/>
ISSN 1090-0535