Table 1 of Morgans, Mol Vis 2001; 7:202-209.


Table 1. PCR primer pairs

The PCR primers used to amplify rat a1F cDNA fragments (except for PCR product 8) were designed against the human a1F cDNA sequence (GenBank accession number for CACNA1F is AJ224874) [3]. The primer sequences for amplifying PCR product 8 are from rat, and their location is given relative to the rat sequence (GenBank accession number AF365975). All primer pairs were presumed to span at least one intron. The numbering of the PCR products is based on the product location in the 5' to 3' direction of the cDNA sequence.

  a1F     F = Forward primer, 5'-3'   Location of   Predicted
  PCR                                 primers on     length
product   R = Reverse primer, 5'-3'     CACNA1F       (bp)
-------   -------------------------   -----------   ---------

   1       F: GCAGATGGCCCTTCAATCTC       34-53        1523

           R: GGCAGCGTGTACAGCTGGCC     1524-1505


   2       F: GCAGATGGCCCTTCAATCTC       34-53         851

           R: CCATGTCGGATCCCAGGAAG      885-866


   3       F: CTTCCTGGGATCCGACATGG      866-885        691

           R: GGCAGCGTGTACAGCTGGCC     1524-1505


   4       F: TCCACACACTCCACCAGCAG     1407-1426       260

           R: ATGGTCAACGTGTTGAGG       1666-1649


   5       F: GGCCAGCTGTACACGCTGCC     1505-1524      1935

           R: CCACGAAGATGTTCATCATG     3429-3410


   6       F: ACAACCTGGCCAGTGGAGAT     2305-2324      1133

           R: CCACGAAGATGTTCATCATG     3429-3410


   7       F: CAGCCATGATGGCCCTGTTC     3250-3269      1186

           R: CAGATCCTCTTGAATTCATC     4426-4407


   8       F: TCTTCATGCTCTGTGCCT       4297-4314      1233

           R: AGCCCTGCCTGGTCCTGA       5543-5526


   9       F: CAGGCACCTATCATCGTG       5488-5505       466

           R: TGGACGCAGGCCATCTCG       5953-5936

Morgans, Mol Vis 2001; 7:202-209 <http://www.molvis.org/molvis/v7/a28/>
©2001 Molecular Vision <http://www.molvis.org/molvis/>
ISSN 1090-0535