Figure 2 of
Wistow, Mol Vis 2000;
6:79-84.
Figure 2. Conceptual translation of the CRYGS transcript containing the Mys cryptic splice insertion
Sequences from CRYGS exons 1 and 2 are in red. The translation begins with exon 1 sequences identical to gS, but, diverges in the insert sequence leading to a premature termination (first asterisk). The translation of exon 2 sequences is shown downstream. The alternative splice puts these sequences into a different reading frame which itself contains an upstream stop codon (second asterisk). Thus nothing resembling functional gS could be produced from this transcript.
1 agccattcctgaatttctttcagcactgggaaaaccagtctatgcaccaaaaatgtctaa
M S K
61 aactggaaccaagctcaaagatcctctcaagacagtatccggctctgctcctttcatctg
T G T K L K D P L K T V S G S A P F I *
121 aaatgactcacatagttttcgcccgtgaaatccataaagtaaatcagccacaaggtggcg
[frame-shift]
181 gcataatgccagattactttctatgaagacaaaaattttcaaggc....
* C Q I T F Y E D K N F Q G
|