Figure 2. Conceptual translation of the CRYGS transcript containing the Mys cryptic splice insertion

Sequences from CRYGS exons 1 and 2 are in red. The translation begins with exon 1 sequences identical to gS, but, diverges in the insert sequence leading to a premature termination (first asterisk). The translation of exon 2 sequences is shown downstream. The alternative splice puts these sequences into a different reading frame which itself contains an upstream stop codon (second asterisk). Thus nothing resembling functional gS could be produced from this transcript.

  1   agccattcctgaatttctttcagcactgggaaaaccagtctatgcaccaaaaatgtctaa
                                                           M  S  K

 61   aactggaaccaagctcaaagatcctctcaagacagtatccggctctgctcctttcatctg
        T  G  T  K  L  K  D  P  L  K  T  V  S  G  S  A  P  F  I  *

121   aaatgactcacatagttttcgcccgtgaaatccataaagtaaatcagccacaaggtggcg
                     [frame-shift]

181   gcataatgccagattactttctatgaagacaaaaattttcaaggc....
          *  C  Q  I  T  F  Y  E  D  K  N  F  Q  G