Molecular Vision 1998; 4:27 <http://www.molvis.org/molvis/v4/p27>
Received 5 October 1998 | Accepted 4 December 1998 | Published 8 December 1998
Download
Reprint


The Cloning of GRK7, a Candidate Cone Opsin Kinase, from Cone- and Rod-Dominant Mammalian Retinas

Ellen R. Weiss,1 Dayanidhi Raman,1 Satoko Shirakawa,1 Melissa H. Ducceschi,1 Paul T. Bertram,1 Fulton Wong,2 Timothy W. Kraft,3 Shoji Osawa1
 
 

1Department of Cell Biology and Anatomy, The University of North Carolina at Chapel Hill, Chapel Hill, NC; 2Department of Ophthalmology, Duke University Eye Center, Durham, NC; 3Department of Ophthalmology, University of Alabama, Birmingham, AL

Correspondence to: Shoji Osawa, Ph.D., Department of Cell Biology and Anatomy, The University of North Carolina at Chapel Hill, CB# 7090, 108 Taylor Hall, Chapel Hill, NC, 27599-7090; Phone: (919) 966-7683; FAX: (919) 966-1856; email: [email protected]


Abstract

Purpose: Desensitization in the rod cell of the mammalian retina is initiated when light-activated rhodopsin is phosphorylated by the G protein-coupled receptor kinase (GRK), GRK1, often referred to as rhodopsin kinase. A distinct kinase that specifically phosphorylates cone opsins in a similar manner has not been identified in mammals. To determine the existence of a cone opsin kinase, RNA from the retinas of cone- and rod-dominant mammals was analyzed by PCR.

Methods: RNA prepared from the retinas of two cone-dominant mammals, the thirteen-lined ground squirrel and the eastern chipmunk, and a rod-dominant mammal, the pig, was used to clone a new GRK family member by RT-PCR. The tissue distribution and localization of the kinase in retina were determined by Northern blot hybridization and in situ hybridization. The protein encoded by this cDNA was expressed in human embryonic kidney-293 (HEK-293) cells and compared with bovine GRK1 for its ability to phosphorylate bovine rhodopsin and to undergo autophosphorylation.

Results: The cDNA cloned from ground squirrel contains an open reading frame encoding a 548 amino-acid protein. Sequence analysis indicates that this protein is orthologous to GRK7 recently cloned from O. latipes, the medaka fish. Partial cDNA fragments of GRK7 were also cloned from RNA prepared from eastern chipmunk and pig retinas. In situ hybridization demonstrated widespread labeling in the photoreceptor layer of the ground squirrel retina, consistent with expression in cones. Recombinant ground squirrel GRK7 phosphorylates bovine rhodopsin in a light-dependent manner and can be autophosphorylated, similar to bovine GRK1.

Conclusions: These results indicate that cone- and rod-dominant mammals both express GRK7. The presence of this kinase in cones in the ground squirrel and its ability to phosphorylate rhodopsin suggests that it could function in cone cells as a cone opsin kinase.


Introduction

In the rod cell of the mammalian retina, GRK1, a G protein-coupled receptor kinase (GRK) also referred to as rhodopsin kinase, phosphorylates light-activated rhodopsin and promotes the binding of arrestin to terminate visual signaling by transducin (Gt), the rod cell G protein [1]. Analogous events involved in cone visual signaling are less well-characterized, due to the fact that mammalian retinas generally have many more rods than cones. The cloning of a number of cone-specific proteins with significant homology to their rod cell counterparts [2-12] suggests that the signaling pathway is similar. However, dramatic physiological differences are observed between rods and cones in their responses to light. For example, cones are typically orders of magnitude less sensitive to similar light intensities, their response time is more rapid, and signal termination is faster than in rods [13]. Several mechanisms may account for the difference in the rate of signal termination. For example, the decay of the active forms (meta II) of the cone opsins is faster than the decay of rhodopsin [14,15]. It also seems likely that the lifetime of activated transducin is different in rods and cones, given the new evidence for regulation of GTP hydrolysis of the G protein [alpha]subunits by members of the Regulators of G Protein Signaling (RGS) family. RGS9, which has been shown in vitro to accelerate the rate of GTP hydrolysis for [alpha]t1, the rod cell transducin [alpha]subunit, is actually present at higher levels in cones [16,17]. In addition, differences in the kinetics of opsin phosphorylation and arrestin binding could play a role in the different rates of signal termination observed for rods and cones.

Six GRKs have been cloned from mammals and biochemically characterized [18,19]. Recently, a novel member of the GRK family, GRK7, was cloned from the medaka fish (Oryzias latipes) and was localized specifically to cones, indicating that the cones of lower vertebrates have a distinct GRK [20]. Whether a unique GRK phosphorylates the cone opsins and plays a role in the termination of visual signaling in mammals is unknown. GRK1 has been localized to both rod and cone outer segments in mammals by immunohistochemistry [21], raising the possibility that GRK1 acts to desensitize both rod and cone opsins. However, in patients with Oguchi disease, which is caused by inactivating mutations in GRK1 [22,23], cone responses to light are relatively normal [24], suggesting that GRK1 does not play a major role in cone visual signaling.

The present study describes the cloning of a new mammalian member of the GRK family from the 13-lined ground squirrel and the eastern chipmunk, two cone-dominant mammals, as well as from the pig, a rod-dominant mammal. Sequence analysis suggests that this kinase is mammalian GRK7. The mRNA for this GRK is found exclusively in the retina and only in the photoreceptor cell layer of the ground squirrel retina. Like medaka fish GRK7, the 13-lined ground squirrel GRK7 contains a consensus sequence for geranylgeranylation of the C terminus. Functional studies demonstrate that this kinase phosphorylates bovine rhodopsin in a light-dependent manner and can be autophosphorylated, similar to GRK1. In addition to GRK7, we successfully cloned a partial cDNA fragment of GRK1 from both ground squirrel and pig retina RNA. These results support the existence of a new GRK family member (GRK7) in both cone- and rod-dominant mammalian retinas that is distinct from GRK1 and has the potential to regulate desensitization in cones.


Methods

Preparation of RNA

Thirteen-lined ground squirrels were purchased from TLS Research (Bartlett, IL). Eastern chipmunks were obtained by trapping the animals in Jefferson County, Alabama. The animals were euthanized by carbon dioxide asphyxiation. The eyes were enucleated and the retinas frozen in liquid nitrogen. Animal care guidelines in accordance with those published by the Institute for Laboratory Animal research were followed. Total RNA from ground squirrel and eastern chipmunk retinas was prepared using the TRIzol Reagent (Life Technologies, Gaithersburg, MD) according to the manufacturer's protocols. Poly(A)+ RNA was prepared using the polyATtract Kit (Promega, Madison, WI) following procedures described by the manufacturer. Rat poly(A)+ RNA was purchased from Clontech (Palo Alto, CA).

Cloning of GRK7

Two degenerate primers used previously to clone members of the GRK family [25-29], were modified to recognize all GRKs and used to amplify sequence from rat, 13-lined ground squirrel, and eastern chipmunk retina RNA. Poly(A)+ RNA or total RNA from rat, eastern chipmunk, and thirteen-lined ground squirrel were reverse-transcribed with MMLV reverse transcriptase using either a random hexamer or oligo dT primer (Advantage RT-for-PCR Kit, Clontech). Polymerase chain reaction (PCR) was performed with Pfu polymerase (Stratagene, La Jolla, CA) using two degenerate oligonucleotide primers, GT(ACGT)TA(CT)(AC)G(ACGT)GA(CT)(CT)T(ACGT)AA(AF)CC and A(ACG)(CT)TC(ACGT)GG(ACGT)GCCAT(AG)(AT)A(ACGT)CC, that correspond to amino acids 311-317 (I/VYRDLKP) and 354-360 (GF/YMAPEL/V) of bovine GRK1 within a conserved region of the catalytic domain. A 2-min incubation at 95 °C was followed by 30-35 amplification cycles, each containing 1 min at 95 °C, 1 min at 50 °C and 2 min at 72 °C. An approximately 150-bp fragment isolated on an agarose gel was ligated to pCR-script SK (Stratagene) and sequenced using the dideoxy sequencing method with the enzyme Sequenase (Amersham, Arlington Heights, IL). Alternatively, clones were sequenced at the UNC-CH Automated DNA Sequencing facility on a Model 377 DNA Sequencer (Perkin Elmer, Applied Biosystems Division, Foster City, CA) using the ABI PRISMTMDye Terminator cycle Sequencing Ready Reaction Kit with AmpliTaq DNA Polymerase, FS (Perkin Elmer, Applied Biosystems Division).

The sequence of GRK7 from 13-lined ground squirrel RNA was extended using a Rapid Amplification of cDNA Ends (RACE) strategy [30]. For 3' extension, the 3' RACE System kit (Life Technologies) was used according to the manufacturer's protocols. The GRK7 cDNA was amplified by PCR using two primers, AUAP (Abridged Universal Amplification Primer) and the primer GAGAACGTGCTCCTGGATGACCTCGG, which corresponds to a site (nucleotides 1040-1065) within the 146-bp sequence of GRK7 originally cloned by PCR. A 2.1-kb fragment generated using this method was ligated to pCR-script SK (Stratagene) and sequenced as described above.

For 5' extension of GRK7 from 13-lined ground squirrel RNA, the Marathon cDNA Amplification Kit (Clontech) was used. Approximately 2 µg of total RNA was reverse-transcribed by MMLV reverse transcriptase using the primer GGAATAGCTCGCCTTGTCCATCAGGAT, which corresponds to a site (nucleotides 1163-1189) downstream from the original 146-bp sequence of GRK7. Second strand synthesis was followed by ligation of Marathon cDNA adapters. Amplification of the cDNA of the GRK7 was performed by PCR using the gene-specific primer (described above) and the Adapter-Primer 2. A 1.2-kb fragment was purified and ligated to pCR2.1 (Invitrogen, Carlsbad, CA) and sequenced.

To verify the accuracy of the cDNA sequence, a minimum of 3 clones from different PCR reactions were analyzed for each region. Searches against peptide and nucleotide sequence databanks were performed at the GSC using the BLAST network services. Other sequence analyses were performed using programs from the Wisconsin Package Version 9.0 (Genetics Computer Group, Madison, WI) as described in the legends to Figs. 1 and 2. The nucleotide sequence for 13-lined ground squirrel GRK7 has been deposited in the GenBank databse under the GenBank Accession Number AF063016. The accession numbers of sequences found to be related to GRK7 are: AB009568, O.latipes GRK7; AB009569, O. latipes GRK1; P28327, bovine GRK1; Q15835, human GRK1; P25098, human GRK2; P35626, human GRK3; P32298, human GRK4; P34947, human GRK5; P43250, human GRK6.

A partial fragment of the pig GRK7 cDNA was cloned by PCR using two degenerate oligonucleotide primers, GA(CT)TGGTT(CT)GC(ACGT)ATGGG(ACGT)TG and TC(AGT)AT(CT)TC(AG)TC(ACGT)AC(AG)TC(CT)TT, corresponding to amino acids 368-374 and 476-482 of the ground squirrel sequence, respectively. A partial fragment of GRK1 was isolated from ground squirrel and pig using two degenerate primers, GA(AG)AA(AG)GT(ACGT)GA(AG)AA(CT)AA(AG)GA and TC(CT)TG(AG)AA(AG)AA(CT)TC(ACGT)GT(AG)TC, corresponding to amino acids 394-400 and 499-505 of bovine GRK1, respectively.

Northern blot hybridization analysis

Electrophoresis was performed following procedures described by Qiagen (Chatsworth, CA) in the RNeasy Mini Handbook. Approximately 8 µg of total RNA was electrophoresed on a formaldehyde-agarose gel and electrophoretically transferred to Immobilon-S nylon membrane (Boehringer Mannheim Indiannapolis, IN). The RNA was immobilized by UV crosslinking. The membrane was prehybridized in 6X SSC, 5X Denhardt's solution, 0.5% SDS, 50% formamide and 100 µg/ml salmon sperm DNA at 42 °C for 2 h. A probe corresponding to the initial 146-bp fragment of GRK7 labeled with [32P]dCTP was heat-denatured and incubated with the nylon membrane overnight at 42 °C in the same buffer used for prehybridization. The membrane was washed twice in 2X SSC, 0.5% SDS at room temperature for 15 min and in 0.1X SSC, 0.5% SDS at 68 °C for 1 h and for 30 min. Radioactivity was detected using a Molecular Dynamics PhosphorImager (Sunnyvale, CA).

In situ hybridization

Enucleated ground squirrel eyes were incubated overnight in PBS containing 4% paraformaldehyde, followed by incubation in PBS containing 30% sucrose. The eyes were frozen in liquid nitrogen, cryostat-sectioned at 10 µm and applied to Superfrost Plus microscope slides (VWR, Plainfield, NJ). In situ hybridization was performed essentially as described with minor modifications [31]. After prehybridization for 1 hour, the slides were hybridized in prehybridization buffer plus 0.2 mg/ml dextran sulfate containing an [35S]UTP-labeled 146-bp fragment of GRK7 as a probe. Slides were hybridized overnight, then washed in 2X SSC, incubated for 30 min in 50% formamide, 1X SSC, 10 mM dithiothreitol (DTT) at 50 °C for 30 min, and for 30 min at room temperature in 0.5X SSC. After incubation in 0.1 mg/ml RNAse for 30 min at room temperature, the slides were washed in 0.1X SSC at 62 °C for 2 h and dehydrated through a series of ethanol concentrations in 300 mM NH4 acetate. For visualization of probe hybridization, the slides were coated with emulsion (Kodak NTB-2), dried and developed according to the manufacturer's directions (Kodak, Rochester, NY). The sections were counterstained with toluidine blue.

Construction of GRK7 expression vectors

The full sequence of GRK7 was generated by PCR from N- and C-terminal clones. A histidine-tagged construct was created by PCR through the insertion of a 6x histidine tag sequence at the N terminus (MRGSHHHHHH) of the protein. HindIII and XhoI sites were created in both the wild-type and histidine-tagged constructs at the 5' and 3' ends, respectively. The constructs were ligated into pSP72 (Promega) for in vitro translation or into pcDNAI/Amp (Invitrogen) for transient expression in HEK-293 cells.

In vitro translation

The wild-type and histidine-tagged constructs of GRK7-pSP72 were linearized with XhoI and transcribed using T7 RNA polymerase. Approximately 1 µg of synthesized RNA was added to rabbit reticulocyte lysate (Promega) in the presence of [35S]methionine and incubated at 30 °C for 1 h. The reaction mixture was analyzed by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) [32] and radioactivity was detected by phosphorimage analysis of the dried gel.

Expression in HEK-293 cells

Transfection of HEK-293 cells was carried out using a DEAE-dextran transfection method essentially as described [33]. Cells were harvested approximately 70 h after transfection. Cell extracts were prepared by freezing and thawing the cells once at -80 °C and dounce homogenization in a buffer consisting of 20 mM HEPES, pH 7.2, 250 mM NaCl, 2 mM EDTA, 0.02% Triton X-100, 1 mM DTT, 0.5 mM PMSF, 20 µg/ml leupeptin, and 20 µg/ml benzamidine [34]. The cell lysates were centrifuged at 40,000 x g in a Ti70 rotor (Beckman, Palo Alto, CA) for 20 min at 4 °C and the supernatants containing the expressed GRK7 or GRK1 were used in experiments described below. Alternatively, the lysates were diluted to 50% with glycerol and stored at -20 °C.

Phosphorylation of rhodopsin by GRK7

An assay mixture containing 4 µg of urea-stripped rod outer segment (ROS) membranes [35] and 5 µg of the HEK-293 cell lysate in 20 mM Tris buffer pH 7.5, 2 mM EDTA, 5 mM MgCl2 and 0.1 mM [[gamma]-32P]ATP (40 µCi/ml) was incubated in the presence or absence of light for 10 min at 30 °C. The reaction was stopped by addition of SDS-PAGE sample buffer [32] and electrophoresed on 10% SDS-polyacrylamide gels. The phosphorylation of rhodopsin was detected by phosphorimage analysis of the dried gels.

Autophosphorylation of GRK7

Approximately 400 µg of cell lysate from HEK-293 cells transfected with the histidine-tagged construct was diluted into 2 ml of buffer containing 10 mM imidazole, pH 7.2, 100 mM NaCl, 2 µg/ml leupeptin, and 1 µg/ml aprotinin and incubated with 50 µl Ni-NTA resin (Qiagen) for 60 min at 4 °C. After washing the resin twice with buffer A containing 20 mM imidazole, 250 mM NaCl, 0.02% Triton X-100, 2 µg/ml leupeptin, and 1 µg/ml aprotinin to remove unbound protein, the GRK7-resin complexes were assayed for the ability of GRK7 to undergo autophosphorylation. The complexes were incubated for 10 min at 30 °C in a buffer containing 20 mM Tris-HCl, pH 7.5, 100 mM NaCl, 5 mM MgCl2, 1 mM DTT, 10 mM NaF and 0.1 mM [[gamma]32P]ATP (20 µCi/ml) [36]. After washing with buffer A to remove unincorporated ATP, the protein was released from the resin by incubation with SDS-Laemmli buffer [32] and electrophoresed on 10% SDS-polyacrylamide gels. Phosphorylation of GRK7 was visualized by phosphorimage analysis of the dried gels.


Results

Based on the hypothesis that a cone opsin kinase would be a member of the GRK family, a strategy was developed to clone new GRKs from the retinas of 2 cone-dominant mammals, the eastern chipmunk [37] and the 13-lined ground squirrel [38-39]. PCR primers corresponding to amino acids 311-317 and 354-360 of bovine GRK1 were designed to recognize the known GRK family members and used to screen retinal RNA from these animals. The cloned PCR products were classified according to their sequence and compared with the products from a PCR analysis of RNA from the rat, a rod-dominant animal [40]. As expected, the majority (85%) of GRKs cloned from rat retina RNA were GRK1 (data not shown). GRK1 was not detected in the eastern chipmunk or the 13-lined ground squirrel during this initial screening. However, a 146-bp fragment corresponding to a novel member of the GRK family was cloned from both the ground squirrel and eastern chipmunk. The sequences from these two animals were 91% identical at the amino acid level, excluding the primer hybridization sites, suggesting that they represent orthologous proteins (species homologues) (Figure 1A).

A RACE strategy was used to obtain the 5' and 3' regions of the clone from ground squirrel; 2.1 kb and 1.2 kb fragments, respectively, were obtained that overlapped each other. The full-length cDNA is 3095 bases and contains a single open reading frame from nucleotides 98 to 1744 encoding a polypeptide of 548 amino acids. The calculated molecular mass of the protein is 61,993 Da. The C terminus contains a CAAX motif, coding for posttranslational attachment of a geranylgeranyl group to Cys-545. Alignment of this sequence with the recently cloned GRK7 from O. latipes (Figure 2) demonstrated an overall identity between these two proteins of 59%. In contrast, the ground squirrel GRK was found to be only 48% identical with bovine GRK1. The highly conserved catalytic domains of the GRK family members, consisting of approximately 280 amino acids, were also compared (Table 1). The catalytic domain of the ground squirrel kinase shows greatest identity with O. latipes GRK7 (67%), is more distantly related to GRK1, 4, 5 and 6 (approximately 55-57% identity), and shows the least sequence identity with GRK2 and GRK3 (approximately 40% identity). These results suggest that the ground squirrel GRK is a new mammalian GRK and orthologous to GRK7 cloned from O. latipes. Despite the similarity between ground squirrel GRK7 and GRK1, 4, 5 and 6, analysis of the evolutionary distance between these proteins indicates that this GRK7 is most closely related to GRK1 (not shown), similar to the observations of Hisatomi et al. for O. latipes GRK7 [20].

RT-PCR was used to amplify GRK7 sequence from RNA isolated from the pig retina. The pig retina is rod-dominant, composed of 89% rods and 11% cones [41,42]. Two degenerate olignucleotide primers, based on the sequence of ground squirrel GRK7, were used to clone a 303-bp fragment from pig RNA corresponding to amino acids 375-475 of the ground squirrel protein (Figure 1B). The identity of this region between ground squirrel and pig GRK7 is 84%. In addition, partial fragments of GRK1 were also cloned from both ground squirrel and pig (Figure 1C). This region of ground squirrel GRK1 is 79% and 83% identical to pig and bovine GRK1, respectively. An overlapping region of the GRK7 and GRK1 partial cDNAs, consisting of 78 amino acids, demonstrates only 43% identity to each other in ground squirrel and 47% identity in the pig. Therefore, GRK7 and GRK1 are distinct kinases present in both rod- and cone-dominant mammals.

The distribution of GRK7 in 8 ground squirrel tissue RNA preparations was determined using Northern blot hybridization (Figure 3). A probe corresponding to the original 146-bp sequence of GRK7 hybridized only to retinal RNA. The molecular size of the major band is approximately 3 kb, which corresponds closely to the length of the complete cDNA sequence (3095 bp) of GRK7. Several minor bands are visible above and below the major band. Some of these may be processed forms, or splice variants, of GRK7, such as those reported for GRK1 and GRK4 [21,43,44]. These results suggest that ground squirrel GRK7 is highly tissue-specific in its expression and is found predominantly in the retina. The same probe was used to localize GRK7 messenger RNA by in situ hybridization in histological preparations of ground squirrel retina (Figure 4). The antisense-strand RNA probe hybridized to the photoreceptor cell layer, which is composed of approximately 94% cones and 6% rods [38]. In contrast, the sense-strand RNA probe showed no specific hybridization. These results indicate that GRK7 is distributed exclusively in photoreceptor cells of the 13-lined ground squirrel retina, consistent with a function in cone visual signaling.

To determine whether the cDNA for ground squirrel GRK7 encodes a protein of the correct molecular size, the cDNA was expressed by in vitro translation. The [35S]methionine-labeled, in vitro-translated product of the GRK7 cDNA migrates at approximately 62 kDa, consistent with the molecular size of the protein predicted from the length of the open reading frame (data not shown). Ground squirrel GRK7 and bovine GRK1 were also transiently expressed in HEK-293 cells to compare their ability to phosphorylate rhodopsin. Cytosolic extracts prepared from these cells were analyzed for their ability to phosphorylate bovine rhodopsin in ROS membranes in the light and in the dark (Figure 5). GRK7 and GRK1 were similarly effective at phosphorylating rhodopsin in a light-dependent manner. Extracts prepared from nontransfected cells showed no detectable phosphorylation of rhodopsin. These results indicate that GRK7 can phosphorylate rhodopsin in a light-dependent manner similar to GRK1, consistent with its classification as a GRK family member and with a potential role as a cone opsin kinase.

Autophosphorylation sites have been identified for GRK1, 5, and 6 downstream from the catalytic domain [28,45-48]. Autophosphorylation of GRK1 may regulate the binding of ATP to the catalytic domain and the selectivity for different substrate sites on rhodopsin [46]. Ground squirrel GRK7 has a threonine at position 21, equivalent to a minor autophosphorylation site at Ser-21 in bovine GRK1 (Figure 2). A serine is also present at position 485, which is equivalent to one of two major autophosphorylation sites at Ser-488 in bovine GRK1 [46], suggesting that GRK7 may also be autophosphorylated. A histidine-tagged GRK7 construct expressed in HEK-293 cells was examined for its ability to undergo autophosphorylation. Extracts from transfected and nontransfected cells were partially purified on Ni-NTA resin and incubated with [[gamma]32P]ATP (Figure 6). The results using extracts from transfected cells show the presence of a radioactive protein bound to the resin with a molecular size similar to that of GRK7 identified by in vitro translation. In contrast, this band was not detected in 32P-labeled extracts from nontransfected cells or in the flowthrough from either transfected or nontransfected cell extracts. These results suggest that GRK7, like GRK1, GRK5 and GRK6, is capable of autophosphorylation.


Discussion

The present report describes the cloning of a new member of the mammalian GRK family from the retinas of the 13-lined ground squirrel, the eastern chipmunk and the pig. Comparison of this sequence with known GRK family members and the sequence of the newly cloned GRK7 from O. latipes, the medaka fish, suggests that these proteins are mammalian GRK7. Although its sequence is closely related to GRK1, partial fragments of a different cDNA cloned from the 13-lined ground squirrel and pig show greater homology to GRK1. Therefore cone- and rod-dominant mammals both express GRK1 and GRK7. Northern analysis and in situ hybridization demonstrate that GRK7 is expressed exclusively in the photoreceptor cell layer of the ground squirrel. Approximately 94% of the photoreceptors of the ground squirrel retina are cones [38], making GRK7 an excellent candidate for a cone opsin kinase. Furthermore, in vitro phosphorylation studies show that rhodopsin can serve as a substrate for this kinase, strengthening the likelihood that it can phosphorylate the homologous cone opsins.

An interesting feature of this kinase is the presence of a C terminal CAAX motif coding for the addition of a geranylgeranyl group to Cys-545. In contrast, GRK1 is farnesylated in every species examined, except chicken, where it is geranylgeranylated [21]. The functional consequence of this difference in isoprenylation may be predicted from studies of Inglese et al. [49], who reported that mutation of the C-terminal CAAX box of GRK1 from CVLS to CVLL, to promote geranylgeranylation instead of farnesylation, resulted in constitutive association with the plasma membrane. Therefore GRK7 may be more tightly associated with the membrane than GRK1. It is intriguing to speculate that this difference in posttranslational modification could contribute to the differences in rates of signal termination between rods and cones through differences in rates of phosphorylation. Further analysis of the biochemical properties of this kinase will be necessary to verify such a hypothesis.

Another feature shared by GRK7 with several members of the GRK family is its ability to be autophosphorylated. Thr-21 in GRK7 from the 13-lined ground squirrel is conserved with Ser-21 in bovine GRK1, but this site is absent in O. latipes GRK7, suggesting that it may not be critical for function. Both the 13-lined ground squirrel and O. latipes GRK7 possess a serine at a position corresponding to Ser-488 in bovine GRK1, but Thr-489 in GRK1, which is also autophosphorylated, is a glutamic acid in both GRK7 proteins. It has been suggested that phosphorylation of these residues in GRK1 enhances its release from phosphorylated rhodopsin, thereby serving to limit the stoichiometry of phosphorylation [50,51]. These residues may also play a role in ATP binding [46].

The existence of GRK7 in the retinas of the 13-lined ground squirrel, the eastern chipmunk and the pig, and the ability of rhodopsin to serve as a substrate for this kinase, raise several interesting questions: (1) Does this novel kinase plays a role in mammalian cone visual signaling pathways, similar to the role played by GRK1 in rods, by phosphorylating the cone opsins? (2) If GRK7 participates in cone signaling, do differences exist in the kinetics of cone opsin phosphorylation that may account for the faster signal termination in cones? In the medaka fish, GRK7 was expressed only in cones and GRK1 only in rods [20]. However in mammals, it has been suggested that GRK1 is also in cones [21]. If GRK7 is also found in both rods and cones, it raises the interesting possibility that these two closely-related members of the GRK family cooperate in visual signaling.


Acknowledgements

The authors would like to thank Dr. David Fenstermacher for advice and assistance with DNA sequence analysis software and Dr. Debora Farber for helpful discussions. This work was supported by NIH grants GM47438 (S.O.), GM43582 (E.R.W.), EY11498 (F.W.), and EY10573 (T.W.K), grants from The Foundation Fighting Blindness (S.O. and E.R.W.; F.W.) and a grant from Research to Prevent Blindness (F.W.).


References

1. Zhao X, Palczewski K, Ohguro H. Mechanism of rhodopsin phosphorylation. Biophys Chem 1995; 56:183-8.

2. Nathans J, Thomas D, Hogness DS. Molecular genetics of human color vision: the genes encoding blue, green, and red pigments. Science 1986; 232:193-202.

3. Lochrie MA, Hurley JB, Simon MI. Sequence of the alpha subunit of photoreceptor G protein: homologies between transducin, ras, and elongation factors. Science 1985; 228:96-9.

4. Lerea CL, Somers DE, Hurley JB, Klock IB, Bunt-Milam AH. Identification of specific transducin alpha subunits in retinal rod and cone photoreceptors. Science 1986; 234:77-80.

5. Levine MA, Smallwood PM, Moen PT Jr, Helman LJ, Ahn TG. Molecular cloning of beta 3 subunit, a third form of the G protein beta-subunit polypeptide. Proc Natl Acad Sci U S A 1990; 87:2329-33.

6. Ong OC, Yamane HK, Phan KB, Fong HK, Bok D, Lee RH, Fung BK. Molecular cloning and characterization of the G protein gamma subunit of cone photoreceptors. J Biol Chem 1995; 270:8495-500.

7. Li TS, Volpp K, Applebury ML. Bovine cone photoreceptor cGMP phosphodiesterase structure deduced from a cDNA clone. Proc Natl Acad Sci U S A 1990; 87:293-7.

8. Viczian AS, Piriev NI, Farber DB. Isolation and characterization of a cDNA encoding the alpha' subunit of human cone cGMP-phosphodiesterase. Gene 1995; 166:205-11.

9. Shimizu-Matsumoto A, Itoh K, Inazawa J, Nishida K, Matsumoto Y, Kinoshita S, Matsubara K, Okubo K. Isolation and chromosomal localization of the human cone cGMP phosphodiesterase gamma cDNA (PDE6H). Genomics 1996; 32:121-4.

10. Craft CM, Whitmore DH, Wiechmann AF. Cone arrestin identified by targeting expression of a functional family. J Biol Chem 1994; 269:4613-9.

11. Craft CM, Whitmore DH. The arrestin superfamily: cone arrestins are a fourth family. FEBS Lett 1995; 362:247-55.

12. Bonigk W, Muller F, Middendorff R, Weyand I, Kaupp UB. Two alternatively spliced forms of the cGMP-gated channel alpha subunit from cone photoreceptor are expressed in the chick pineal organ. J Neurosci 1996; 16:7458-68.

13. Yau KW. Phototransduction mechanism in retinal rods and cones. The Friedenwald Lecture. Invest Ophthalmol Vis Sci 1994; 35:9-32.

14. Imai H, Imamoto Y, Yoshizawa T, Shichida Y. Difference in molecular properties between chicken green and rhodopsin as related to the functional difference between cone and rod photoreceptor cells. Biochemistry 1995; 34:10525-31.

15. Imai H, Kojima D, Oura T, Tachibanaki S, Terakita A, Shichida Y. Single amino acid residue as a functional determinant of rod and cone visual pigments. Proc Natl Acad Sci U S A 1997; 94:2322-6.

16. Cowan CW, Fariss RN, Sokal I, Palczewski K, Wensel TG. High expression levels in cones of RGS9, the predominant GTPase accelerating protein of rods. Proc Natl Acad Sci U S A 1998; 95:5351-56.

17. He W, Cowan CW, Wensel TG. RGS9, a GTPase accelerator for phototransduction. Neuron 1998; 20:95-102.

18. Premont RT, Inglese J, Lefkowitz RJ. Protein kinases that phosphorylate activated G protein-coupled receptors. FASEB J 1995; 9:175-82.

19. Palczewski K. GTP-binding-protein-coupled receptor kinases--two mechanistic models. Eur J Biochem 1997; 248:261-9.

20. Hisatomi O, Matsuda S, Satoh T, Kotaka S, Imanishi Y, Tokunaga F. A novel subtype of G-protein-coupled receptor kinase, GRK7, in teleost cone photoreceptors. FEBS Lett 1998; 424:159-64.

21. Zhao X, Huang J, Khani SC, Palczewski K. Molecular forms of human rhodopsin kinase (GRK1). J Biol Chem 1998; 273:5124-31.

22. Yamamoto S, Sippel KC, Berson EL, Dryja TP. Defects in the rhodopsin kinase gene in the Oguchi form of stationary night blindness. Nat Genet 1997; 15:175-8.

23. Khani SC, Nielsen L, Vogt TM. Biochemical evidence for pathogenicity of rhodopsin kinase mutations correlated with the Oguchi form of congenital stationary night blindness. Proc Natl Acad Sci U S A 1998; 95:2824-7.

24. Cideciyan AV, Zhao X, Nielsen L, Khani SC, Jacobson SG, Palczewski K. Null mutation in the rhodopsin kinase gene slows recovery kinetics of rod and cone phototransduction in man. Proc Natl Acad Sci U S A 1998; 95:328-33.

25. Cassill JA, Whitney M, Joazeiro CA, Becker A, Zuker CS. Isolation of Drosophila genes encoding G protein-coupled receptor kinases. Proc Natl Acad Sci U S A 1991; 88:11067-70.

26. Haribabu B, Snyderman R. Identification of additional members of human G-protein-coupled receptor kinase multigene family. Proc Natl Acad Sci U S A 1993; 90:9398-402.

27. Kunapuli P, Benovic JL. Cloning and expression of GRK5: a member of the G protein-coupled receptor kinase family. Proc Natl Acad Sci U S A 1993; 90:5588-92.

28. Premont RT, Koch WJ, Inglese J, Lefkowitz RJ. Identification, purification, and characterization of GRK5, a member of the family of G protein-coupled receptor kinases. J Biol Chem 1994; 269:6832-41.

29. Neill JD, Musgrove LC, Sellers JC, Duck LW. Identification by polymerase chain reaction of the G protein-coupled receptor kinases expressed in the mouse gonadotropic alpha T3-1 cell line. Endocrinology 1996; 137:3942-7.

30. Frohman MA, Dush MK, Martin GR. Rapid production of full-lengh cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer. Proc Natl Acad Sci U S A 1988; 85:8998-9002.

31. Levison SW, Ducceschi MH, Young GM, Wood TL. Acute exposure to CNTF in vivo induces multiple components of reactive gliosis. Exp Neurol 1996; 141:256-68.

32. Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970; 227:680-5.

33. Osawa S, Weiss ER. The effect of carboxyl-terminal mutagenesis of Gt alpha on rhodopsin and guanine nucleotide binding. J Biol Chem 1995; 270:31052-8.

34. Benovic JL, Gomez J. Molecular cloning and expression of GRK6. A new member of the G protein-coupled receptor kinase family. J Biol Chem 1993; 268:19521-7.

35. Kelleher DJ, Johnson GL. Characterization of rhodopsin kinase purified from bovine rod outer segments. J Biol Chem 1990; 265:2632-9.

36. Shi W, Osawa S, Dickerson CD, Weiss ER. Rhodopsin mutants discriminate sites important for the activation of rhodopsin kinase and Gt. J Biol Chem 1995; 270:2112-9.

37. Hara S, Miyoshi M. Gap junctions between visual cells in the squirrel retina. Biomedical Research 1984; 5:101-10.

38. von Schantz M, Szel A, van Veen T, Farber DB. Expression of phototransduction cascade genes in the ground squirrel retina. [published erratum appears in Invest Ophthalmol Vis Sci 1995; 36:3] Invest Ophthalmol Vis Sci 1994; 35:2558-66.

39. von Schantz M, Szel A, van Veen T, Farber DB. Expression of soluble phototransduction-associated proteins in ground squirrel retina. Invest Ophthalmol Vis Sci 1994; 35:3922-30.

40. Tansley K. Comparative anatomy of the mammalian retina with respect to the electroretinographic response to light. In: Smelser GK, editor. The structure of the eye. New York: Academic Press; 1961. p. 193-206.

41. Prince JH, Diesem CD, Eglitis I, Ruskell GL. Anatomy and histology of the eye and orbit in domestic animals. Springfield (IL): C. C. Thomas; 1960. pp. 210-33.

42. Gerke CG, Hao Y, Wong F. Topography of rods and cones in the retina of the domestic pig. Hong Kong Medical Journal 1995; 1:302-8.

43. Premont RT, Macrae AD, Stoffel RH, Chung N, Pitcher JA, Ambrose C, Inglese J, MacDonald ME, Lefkowitz RJ. Characterization of the G protein-coupled receptor kinase GRK4. Identification of four splice variants. J Biol Chem 1996; 271:6403-10.

44. Sallese M, Mariggio S, Collodel G, Moretti E, Piomboni P, Baccetti B, De Blasi A. G protein-coupled receptor kinase GRK4. Molecular analysis of the four isoforms and ultrastructural localization in spermatozoa and germinal cells. J Biol Chem 1997; 272:10188-95.

45. Palczewski K, Buczylko J, Van Hooser P, Carr SA, Huddleston MJ, Crabb JW. Identification of the autophosphorylation sites in rhodopsin kinase. J Biol Chem 1992; 267:18991-8.

46. Palczewski K, Ohguro H, Premont RT, Inglese J. Rhodopsin kinase autophosphorylation. Characterization of site-specific mutations. J Biol Chem 1995; 270:15294-8.

47. Kunapuli P, Gurevich VV, Benovic JL. Phospholipid-stimulated autophosphorylation activates the G protein-coupled receptor kinase GRK5. J Biol Chem 1994; 269:10209-12.

48. Loudon RP, Benovic JL. Expression, purification, and characterization of the G protein-coupled receptor kinase GRK6. J Biol Chem 1994; 269:22691-97.

49. Inglese J, Koch WJ, Caron MG, Lefkowitz RJ. Isoprenylation in regulation of signal transduction by G-protein-coupled receptor kinases. Nature 1992; 359:147-50.

50. Buczylko J, Gutmann C, Palczewski K. Regulation of rhodopsin kinase by autophosphorylation. Proc Natl Acad Sci U S A 1991; 88:2568-72.

51. Pulvermüller A, Palczewski K, Hofmann KP. Interaction between photoactivated rhodopsin and its kinase: stability and kinetics of complex formation. Biochemistry 1993; 32:14082-8.

Typographical corrections


Weiss, Mol Vis 1998; 4:27 <http://www.molvis.org/molvis/v4/p27>
©1998 Molecular Vision <http://www.molvis.org/molvis/>
ISSN 1090-0535