Exon     Oligo Sequence (5' -> 3')       Orientation

  1      ccagccatctggaactcaacaacggc           F

  2      gcttcaccacctgctccttgagcttc           RC

  2      tcctggccaggtgactgaggccgtg            F

  3      cttgaaccccgttggccagtg                RC

  3      agcgacctgcagctggactacctgg            F

  4      tcactaggtatcacgttccctgagg            RC

  4      tcagggaacgtgatacctagtgacacc          F

  5      tgaagagggttgaagttggagacacc           RC

  5      gctatggaacaactagtggatg               F

  6      agggcctgtcaggagaaccaag               RC

  6      atcgagtgccacccgtacctaac              F

  7      ctgggctgtagttttattgtac               RC

  7      caagcctgaagatccgtctctc               F

  8      cttcaagttctcagcaatgcg                RC

  8      gtgctgatccggttccccattc               F

  9      ctcatcaaggcgcacaccctcc               RC

  9      gtctttgactttgaggtgagcag              F

 10      ggctactggtactgccctccag               RC

Oligonucleotide sequence is given for each exon specific primer. Orientation of primer relative to the mouse AR cDNA sequence is given as either the forward (F) or reverse complement (RC) sequence.

SPECIES   CONSTRUCT      ISOTONIC        HYPERTONIC        H/I

MOUSE         1        16.34 ± 1.99    100.00 ±  4.29      6.12
              2        25.66 ± 5.87     49.71 ±  4.43      1.94
              3        12.42 ± 0.64     30.00 ±  3.54      2.42
              4        10.11 ± 1.59     32.46 ± 10.78*     3.21

RAT           1        35.17 ± 3.59     92.45 ±  6.38      2.63
              2        45.24 ± 4.22     52.87 ±  5.60      1.17
              3        57.99 ± 5.44     51.55 ±  2.68      0.89
              4        51.23 ± 2.53     55.36 ±  3.93      1.08

HUMAN         1        14.64 ± 0.83     55.19 ±  8.35      3.77
              2         8.35 ± 0.64      7.61 ±  0.42      0.91
              3         8.43 ± 0.57      8.17 ±  0.60      0.97
              4        11.95 ± 0.94     13.40 ±  0.70      1.12
______________________________________________________________

MOUSE (WT)             18.31 ± 0.86     90.00 ±  8.35      4.92

MOUSE (AEE)            12.18 ± 0.51     57.74 ± 19.84      4.74

MOUSE (TonE)            7.46 ± 1.49     12.87 ±  4.50      1.73

Relative luciferase activities of AR promoter constructs in mouse [alpha]TN4 cells grown under isotonic and hypertonic conditions. Top panel; In a representative experiment, Mouse, Rat, and Human AR promoter results indicate mean of six replicates (where ^*, n = 4) ± standard deviation. Bottom panel; In a separate experiment, mouse WT, AEE, and TonE results indicate mean of three replicates ±standard deviation. The osmotic induction is represented by the ratio of hypertonic to isotonic promoter activities (H/I).