Tables for
McGowan, Mol Vis 4:2, 1998.
Table I. Primers used for PCR analysis of mouse AR gene structure
Exon Oligo Sequence (5' -> 3') Orientation 1 ccagccatctggaactcaacaacggc F 2 gcttcaccacctgctccttgagcttc RC 2 tcctggccaggtgactgaggccgtg F 3 cttgaaccccgttggccagtg RC 3 agcgacctgcagctggactacctgg F 4 tcactaggtatcacgttccctgagg RC 4 tcagggaacgtgatacctagtgacacc F 5 tgaagagggttgaagttggagacacc RC 5 gctatggaacaactagtggatg F 6 agggcctgtcaggagaaccaag RC 6 atcgagtgccacccgtacctaac F 7 ctgggctgtagttttattgtac RC 7 caagcctgaagatccgtctctc F 8 cttcaagttctcagcaatgcg RC 8 gtgctgatccggttccccattc F 9 ctcatcaaggcgcacaccctcc RC 9 gtctttgactttgaggtgagcag F 10 ggctactggtactgccctccag RC Oligonucleotide sequence is given for each exon specific primer. Orientation of primer relative to the mouse AR cDNA sequence is given as either the forward (F) or reverse complement (RC) sequence. |
Table II. AR Promoter Activity
SPECIES CONSTRUCT ISOTONIC HYPERTONIC H/I
MOUSE 1 16.34 ± 1.99 100.00 ± 4.29 6.12
2 25.66 ± 5.87 49.71 ± 4.43 1.94
3 12.42 ± 0.64 30.00 ± 3.54 2.42
4 10.11 ± 1.59 32.46 ± 10.78* 3.21
RAT 1 35.17 ± 3.59 92.45 ± 6.38 2.63
2 45.24 ± 4.22 52.87 ± 5.60 1.17
3 57.99 ± 5.44 51.55 ± 2.68 0.89
4 51.23 ± 2.53 55.36 ± 3.93 1.08
HUMAN 1 14.64 ± 0.83 55.19 ± 8.35 3.77
2 8.35 ± 0.64 7.61 ± 0.42 0.91
3 8.43 ± 0.57 8.17 ± 0.60 0.97
4 11.95 ± 0.94 13.40 ± 0.70 1.12
______________________________________________________________
MOUSE (WT) 18.31 ± 0.86 90.00 ± 8.35 4.92
MOUSE (AEE) 12.18 ± 0.51 57.74 ± 19.84 4.74
MOUSE (TonE) 7.46 ± 1.49 12.87 ± 4.50 1.73
Relative luciferase activities of AR promoter constructs in mouse [alpha]TN4 cells grown under isotonic and hypertonic conditions. Top panel; In a representative experiment, Mouse, Rat, and Human AR promoter results indicate mean of six replicates (where *, n = 4) ± standard deviation. Bottom panel; In a separate experiment, mouse WT, AEE, and TonE results indicate mean of three replicates ±standard deviation. The osmotic induction is represented by the ratio of hypertonic to isotonic promoter activities (H/I). |