Table 1 of Fuma, Mol Vis 2024; 30:219-228.


Table 1. Primer sequences used in real-time PCR.

Gene name Primer sequence (5’-3’)
Vegfa F: ACATTGGCTCACTTCCAGAAACAC
  R: GGTTGGAACCGGCATCTTTATC
Il6 F: TCTGCAAGAGACTTCCATCCAGT
  R: TCTGCAACTGCATCATCGTTGT
Tnf-α F: GAGTGACAAGCCTGTAGCC
  R: CTCCTGGTATGAGATAGCAAA
Atf4 F: AGGAGTTCGCCTTGGATGCCCTG
  R: AGTGATATCCACTTCACTGCCCAG
Gapdh F: GGGATGGTCCTTGCATCAGAA
  R: ACTGGTAGCCACTGGTCTGGTTG