Table 1 of Yesilirmak, Mol Vis 2024; 30:211-218.


Table 1. List of primers used in the study.

        Gene         Primer sequences (5′-3′)
        TLR-4         F: GTGCCTCCATTTCAGCTCTG
        TLR-4         R: CAAAGATACACCAGCGGCTC
        GAPDH         F: GAAGGTGAAGGTCGGAGTCAAC
        GAPDH         R: CAGAGTTAAAAGCAGCCCTGGT