Table 1 of Liu, Mol Vis 2024; 30:200-210.


Table 1. Primers sequences.

Gene Nucleotide Sequence (5′-3′) Primer
GAPDH
GAPDH ACTCCTCCACCTTTGACGCT
GGTCTCTCTCTTCCTCTTGTGC F
R
IL-6
IL-6 TTCGGTCCAGTTGCCTTCT
GGTGAGTGGCTGTCTGTGTG F
R
IL-8
IL-8 GGGTGGAAAGGTTTGGAGTAT
TAGGACAAGAGCCAGGAAGAA F
R
Integrin α5
Integrin α5 GGGTGGCCTTCGGTTTA
GCTTTGCGAGTTGTTGAGAT F
R
Integrin β1
Integrin β1 CCTACTTCTGCACGATG
TTTGCTACGGTTGGTTA F
R
α-SMA
α-SMA CCGACCGAATGCAGAAGGA
ACAGAGTATTTGCGCTCCGGA F
R
Fibronectin
Fibronectin AATATCTCGGTGCCATTTGC
AAAGGCATGAAGCACTCAAT F
R
CTGF
CTGF GCGGCTTACCGACTGGA
ACAGGCGGCTCTGCTTC F
R