Table 1 of Peng, Mol Vis 2024; 30:123-136.


Table 1. The primers used in this study.

Purpose Symble Forward Reverse length (bp)
PGEMT-easy-cryaaPro cryaa-promoter TGGAGACCCCTGATTAATAA AATGTCAGACCTGGTAACTCCT 1028
pTol cryaa:Cre-polyA cryaa-promoter* GGAGATCACTTAGATCTAACTGGAGACCCCTGATTAATAA ACGGTCAGTAAATTGGCCATAATGTCAGACCTGGTAACTCCT 1068
Cre* GAGTTACCAGGTCTGACATTATGGCCAATTTACTGACCGTACA TATGGCTGATTATGATCTAGCTAATCGCCATCTTCCAGCAG 1072
SV40-ployA* TGCTGGAAGATGGCGATTAGCTAGATCATAATCAGCCATACCA GTTTCCCGGGTTCGTACGTTctgcagACGCCTTAAGATACATTGATGA 283
pTol cryaa:Cre-polyA
-cryaa:EGFP cryaa-promoter* CGTCTGCAGAACGTACGAAC TGGAGACCCCTGATTAATAA CCCTTGCTCACCATGGTGGCAATGTCAGACCTGGTAACTCCT 1068
EGFP-ploy A* GAGTTACCAGGTCTGACATTGCCACCATGGTGAGCAAGGGC TTTTCTCGAGTTACGCGTTTcccgggACGCCTTAAGATACATTGATGA 1016
in situ hybridization cryaa-antisense
probe** GGACCCAAGACAAGTGGCAT TAATACGACTCACTATAGCAGGTTAGGGAGAAAGCGGAG 757
cryaa-sense
probe** TAATACGACTCACTATAGGGACCCAAGACAAGTGGCAT CAGGTTAGGGAGAAAGCGGAG 757
egfp-antisense
probe** GCCACCATGGTGAGCAAGGGC TAATACGACTCACTATAGTGGTATGGCTGATTATGATCTAG 780
egfp-sense
probe** TAATACGACTCACTATAGGCCACCATGGTGAGCAAGGGC TGGTATGGCTGATTATGATCTAG 780
cre-antisense
probe** ATGGCCAATTTACTGACCGTACA TAATACGACTCACTATAGCTTCTCTACACCTGCGGTGCTAA 651
cre-sense
probe** TAATACGACTCACTATAGATGGCCAATTTACTGACCGTACA CTTCTCTACACCTGCGGTGCTAA 651
qRT-PCR cryaa TACCCCACCCGACTCTTTGA AGTCCAGGATGTTGCGGAAG 124
  actb2 GATGATGAAATTGCCGCACTG ACCAACCATGACACCCTGATGT 135