Table 1 of Feng, Mol Vis 2024; 30:1-17.


Table 1. The primer sequences.

Gene Primer (5’-3’)
GAPDH CTACCCACGGCAAGTTCAAC
GAPDH CCAGTAGACTCCACGACATAC
IL-1β TCCTCTGTGACTCGTGGGAT
IL-1β TCAGACAGCACGAGGCATTT
IL-6 CCAGCCAGTTGCCTTCTTG
IL-6 AATTAAGCCTCCGACTTGTGTGAA
IL-10 GTGGAGCAGGTGAAGAATGATT
IL-10 CGTAGGCTTCTATGCAGTTGAT