GPR143 mutations in an X-linked infantile nystagmus syndrome cohort in Southeast China

• Introduction
• Methods
• Results
• Discussion

Abstract

Purpose: Infantile nystagmus syndrome (INS), or congenital nystagmus (CN), refers to a group of ocular motor disorders characterized by rapid to-and-fro oscillations of the eyes. GPR143 is the causative gene of ocular albinism type 1 (OA1), which is a special type of INS that manifests as reduced vision, nystagmus, and iris and fundus hypopigmentation. Here, we explored the genetic spectrum of INS and the genotype–phenotype correlation.

Methods: A total of 98 families with INS from Southeast China were recruited for this study. A sample from each participant was subjected to PCR-based DNA direct sequencing of GPR143. Varied bioinformatics analysis was subsequently used in a mutation assessment. All participants received detailed ophthalmic examinations.

Results: Genetic analysis identified 11 GPR143 mutations in 11.2% (11/98) of the X-linked INS families. These included seven novel mutations (c.899 C>T, c.886–2 A>G, c.1A>G, c.633_643del CCTGTTCCAAA, c.162_198delCGCGGGCCCCGGGTCCCCCGCGACGTCCCCGCCGGCC, c.628C>A, and c.178_179insGGGTCCC) and four known mutations. Patients who carried a GPR143 mutation were found to present a typical or atypical phenotype of OA1. All patients with GPR143 mutations manifested foveal hypoplasia; thus, about 45.8% (11/24) of the families with total X-linked INS exhibited foveal hypoplasia.

Conclusions: We discovered seven novel mutations and four previously reported mutations of GPR143 in a cohort of families with X-linked INS and enlarged the Chinese genetic spectrum of INS. These findings offer new insights for developing genetic screening strategies and shed light on the importance of conducting genetic analysis in confirming the clinical diagnosis in unresolved patients and atypical phenotypes.

Infantile nystagmus syndrome (INS), also known as congenital nystagmus (CN), is an oculomotor control disorder. INS is characterized by involuntary, periodic, rapid to-and-fro oscillations of the eyes. This disease appears at birth or develops after approximately 3–6 months. The prevalence of INS in the general population has been estimated to range from 0.03% to 0.24% [1,2]. Some patients develop abnormal head position (AHP) to reduce nystagmus and obtain better vision [2]. INS has been divided into two types: congenital motive nystagmus (CMN) or isolated nystagmus, and congenital sensory nystagmus (CSM). While CMN is not accompanied by ocular abnormalities, CSM is accompanied by other ocular disorders, including ocular albinism, congenital cataract, congenital corneal leukoma, strabismus, aniridia, achromatopsia, Leber congenital amaurosis, retinitis pigmentosa, cone–rod dystrophy, macular coloboma, and optic nerve hypoplasia [2,3]. According to the literature, there seems to be no cure for INS. Extraocular muscle surgery, optical therapy, and drug therapy have been used to improve visual acuity, reduce nystagmus, and correct AHP [4,5].

Various modes of inheritance of INS have been reported, including X-linked inheritance, autosomal dominant inheritance, and autosomal recessive inheritance [6]. The gene GPR143, also known as OA1, is one of the causative genes of X-linked INS. GPR143 is located in Xp22.2 and encodes G protein-coupled receptor 143 (GPR143), which is the receptor for tyrosine, Levadopa, and dopamine. GPR143 is enriched in melanocytes and iris and retinal pigment epithelium and is involved in melanosome biogenesis, organization, and transport mechanisms. However, despite more than 100 mutations in GPR143 being recorded in the human gene mutation database (HGMD), the pathogenic mechanism of GPR143 has not been confirmed. It is known, however, that GPR143 mutations cause ocular albinism type 1 (OA1), which is a special type of INS. People with OA1 exhibit reduced vision, nystagmus, foveal hypoplasia, iris hypopigmentation, and albinistic fundus. OA1 affects only the eyes; it does not affect the pigmentation of hair and skin. Iris hypopigmentation and albinistic fundus tend to be more atypical or mild in Chinese patients, and Chinese OA1 patients are often simply misdiagnosed with isolated nystagmus [7-11].

In this study, we aimed to explore the genetic spectrum of INS and the genotype–phenotype correlation. We enrolled 98 families from Southeast China who had been initially diagnosed with X-linked INS. We then performed Sanger sequencing of all coding exons and splicing sites of GPR143. A total of seven novel mutations and four known mutations of GPR143 were found in 11 unrelated Chinese families.

A total of 98 families from Southeast China who had been initially diagnosed with X-linked INS were enrolled in this study. We identified seven novel mutations and four known mutations of GPR143 in 11 unrelated families. The probands with mutations all exhibited nystagmus, foveal hypoplasia, reduced visual acuity (BCVA less than 0.4), and normal skin and hair color. Most (81.8%, 9/11) of the patients had different degrees of fundus hypopigmentation, and 45.5% (5/11) of the patients had mild degrees of iris hypopigmentation.

Clinical features of OA1 vary among different ethnic groups. The most prominent signs in Caucasian patients with OA1 are iris translucency, foveal hypoplasia, and fundus hypopigmentation [13-16]. African American males with OA1 have non-albinotic, moderately pigmented fundi, and no translucency of the iris [16]. Japanese patients have fundus hypopigmentation at a level between that of Caucasian and African American patients [17,18]. Therefore, it has been widely acknowledged that the level of ocular hypopigmentation is related to ethnic origin. Iris hypopigmentation and fundus hypopigmentation are usually mild in reported Chinese OA1 cases [19]. Due to the insidious and slight depigmentation of the iris and fundus, Chinese OA1 patients are prone to being misdiagnosed with isolated nystagmus.

In this study, the GPR143 mutation detection rate was 11.22% (11/98). However, the mutation detection rate in families with foveal hypoplasia was significantly higher at 45.9% (11/24). Therefore, the application of genetic testing is crucial for the precise diagnosis of INS, especially in patients with foveal hypoplasia or cases of suspected clinical manifestations of albinism.

GPR143 consists of nine exons that span approximately 40 kb on chromosome Xp22.2, and it encodes a protein comprising 404 amino acids (Figure 6). GPR143 is expressed exclusively in melanosomes, a type of intracellular organelle, and is abundant in the retinal pigment epithelium (RPE) and melanocytes. However, the details of the molecular mechanism(s) associated with GPR143 mutations that cause ocular abnormalities are still unclear. A hypothesis has been proposed that L-DOPA (a precursor in melanin synthesis) is a ligand of GPR143 in melanosomal biogenesis [20]. Mutations in GPR143 could thus hinder melanin synthesis in the RPE and result in RPE hypopigmentation. This condition could then result in abnormal development of the retina and visual pathways, thereby causing nystagmus, misrouting of the optic fibers, foveal hypoplasia, and reduced visual acuity [7,21-24].

Three novel frameshift variants (c.178_179insGGGTCCC/P60Rfs*43, c.633_643del CCTGTTCCAAA, and c.162_198delCGCGGGCCCCGGGTCCCCCGCGACGTCCCCGCCGGCC) in GRP143 were predicted to generate abnormal mRNA with a premature termination codon (PTC). These abnormal mRNAs with a PTC could be degraded under the nonsense-mediated mRNA decay (NMD) surveillance mechanism or generate defective truncated proteins that escape NMD surveillance.

A novel splicing mutation (c.886–2 A>G) was identified in the 3′ consensus acceptor region for the splicing of introns 8–9. Another novel mutation (c.1A>G) was predicted to alter the splice site. Such splice site displacement may result in short abnormal mRNA sequences and further generate truncated or nonfunctional proteins. In addition, two missense mutations (c.899 C>T/p.P300L and c.628C>A/p.P210T) were found for the first time in Southeast Chinese patients, and these mutations were also absent from the gnomAD. The crystal structure modeling of P300L and P210T in GRP143 showed significant structural alterations in the presence of the mutations, which might affect the quantity and quality of melanin in the tissues.

Four previously reported mutations were also detected in families recruited for this study. To our knowledge, in this study, two known missense mutations (c.346T>C, p.C116R and c.488 G>A, p.G163D) were identified for the first time in Chinese INS patients. The splicing mutation c.360+1G>C has been reported previously in Chinese patients with X-linked ocular albinism [25]. The phenotype of Chinese patients carrying the mutation c.360+1G>C was similar, with low visual acuity, macular dysplasia, INS, and fundus depigmentation. The mutation c.733C>T was first reported in a Korean family with X-linked INS [26]. It was subsequently also found sporadically in Chinese patients [11] and in another unrelated Chinese family with X-linked INS [27]. The mutation c.733C>T is likely to be a hotspot mutation in Chinese and East Asian INS populations.

The characteristics of GPR143 mutation sites found in the Chinese population were summarized for the first time in this study. Our findings show that up to 88.9% of identified mutations have been located in or near putative transmembrane domains. This finding suggests that the seven putative transmembrane domains of GPR143 are the most frequently mutated regions in Chinese OA1 patients and that the structural stability of the transmembrane domains is vital to the function of melanosomes.

In summary, we investigated 98 families from Southeast China with X-linked INS and identified 11 mutations in GPR143, including seven novel mutations and four previously described mutations. Identifying these mutations has deepened our understanding of the gene spectrum in patients in Southeast China. Genetic analysis can effectively improve the diagnostic accuracy of unresolved OA1 patients and atypical OA1 phenotypes. More effort should be put into elucidating the pathogenic mechanism of and possible gene therapies for nystagmus in the future.