Table 1 of Sharma, Mol Vis 2015; 21:974-984.


Table 1. Nucleotide sequences of two validated RNAi and siRNA oligos used in the study.

Smad2 RNAi-1 validated (5′ to 3′) GAGCAGAACCTCTCTGAATTTGGTTTTGGCCACTGACTGACCAAATTCAGAGGTTCTGCT
Smad2 RNAi-2 validated (5′ to 3′) GTGTAAAGGCCTGTTGTATCCCGTTTTGGCCACTGACTGACGGGATACAAGGCCTTTACA
Smad3 RNAi-1 validated (5′ to 3′) GCACTGAGGCACTCTGCGAAGAGTTTTGGCCACTGACTGACTCTTCGCAGTGCCTCAGTG
Smad3 RNAi-2 validated (5′ to 3′) GTTCATCTGGTGGTCACTGGTTGTTTTGGCCACTGACTGACAACCAGTGCACCAGATGAA
Smad4 RNAi-1 validated (5′ to 3′) GTATGATGGTAAGTAGCTGGCTGTTTTGGCCACTGACTGACAGCCAGCTTTACCATCATA
Smad4 RNAi-2 validated (5′ to 3′) GTTTCCGACCAGCCACCTGAAGGTTTTGGCCACTGACTGACCTTCAGGTCTGGTCGGAAA
TGIF1 siRNA-1 validated (5′ to 3′) GCAUGGACAUUCCCUUGGATT
TGIF1 siRNA-2 validated (5′ to 3′) GCACCGUUACAAUGCCUAUTT
TGIF2 siRNA-1 validated (5′ to 3′) GCCUCCUAGCUGGGAUUGUTT
TGIF2 siRNA-2 validated (5′ to 3′) GGACGACAGCCUUUAGUUUTT