Table 1 of
Jin, Mol Vis 2014; 20:553-560. Table 1 of
Jin, Mol Vis 2014; 20:553-560.
Table 1. Primers used for potential pathogenic mutations amplification.
| Mutation | Gene | Forward primer (5’-3’) | Reverse primer (5’-3’) | Product length (bp) |
|---|---|---|---|---|
| c.942_944delGAA | IMPDH1 | caccaagcctgcttcatttc | gggtcctcataaacctccac | 310 |
| c.1924T>A | ABCA4 | ccatcctttgtccctctgtg | actccagcacccccattag | 261 |
| c.272A>G | NMNAT1 | ttgatcgtaatatttcctgt | aagccgcttagccatttaca | 308 |
| c.196C>T | NMNAT1 | ttgatcgtaatatttcctgt | aagccgcttagccatttaca | 308 |