Table 1 of Wang, Mol Vis 1996; 2:3.


Table 1. Sequence and location of primers used for PCR

Primers (PDEA-1 to PDEA-4) used for RT-PCR correspond to the human (h) PDEalpha cDNA sequence, selected from the consensus region in different species. All other PDEA primers correspond to canine (c) PDEalpha cDNA sequence. Location of all the PDEA primers are shown with respect to cPDEalpha cDNA sequence. Nucleotides (shown in lower case) in some primers have mismatches with the canine sequence because those primers were selected either from the human sequence, or from preliminary canine sequence. Phagemid vector (pBK-CMV) specific primers were selected either from the multiple cloning site or from the flanking region. The bold-italicized region of primer pBK-V represents the linker used to make the canine cDNA library.

Primer sequence(5'to3')      Source of Primer   Name of primer   Location
--------------------------   ----------------   --------------   ---------

gCTTTGCCAAACAGTACTACAACC      hPDEalpha cDNA        PDEA1         192-215
AgTTGTGcAGGTAACTCAGGTG        hPDEalpha cDNA        PDEA2         815-836
GGCCCTGGTGCGgTTC              hPDEalpha cDNA        PDEA3        1759-1774
ATGGGATTCTGtTGCAGCAC          hPDEalpha cDNA        PDEA4        2393-2412
TTCAACGTGGGGCAGACCAT          cPDEalpha cDNA        PDEA5        1832-1851
CACTACGTCCTTCCCATTCATTATGG    cPDEalpha cDNA        PDEA6         681-706
GTCATaAAGAAGCTGTGCTTCCTCC     cPDEalpha cDNA        PDEA7         380-404
GTCATGGGTGAGGTGACAGCAGAG      cPDEalpha cDNA        PDEA9         137-160
cCAACGTTTTGCCGAACTCCAAG       cPDEalpha cDNA        PDEA11       2032-2054
TCCACCCTATTCTGGTCCCA          cPDEalpha cDNA        PDEA16       1036-1055
ATGGTCTGCCCCACGTTGAAGCC       cPDEalpha cDNA        PDEA17       1829-1851
TTGCTTGGCTGTCTGCTGCTT         cPDEalpha cDNA        PDEA18       2624-2644
GCAGGTCGACACTAGTGGATCC        pBKCMV                pBKII        1092-1113
CCGCTCTAGAAGTACTCTCGAGTT     pBKCMV                pBKV         1052-1067
CGACTCACTATAGGGCGAATT         pBKCMV                T7            980-1000

Wang, Mol Vis 1996; 2:3 <http://www.molvis.org/molvis/v2/a3/>
©1996 Molecular Vision <http://www.molvis.org/molvis/>
ISSN 1090-0535