Table 1 of
Méndez-Vidal, Mol Vis 2013; 19:2187-2195. Table 1 of
Méndez-Vidal, Mol Vis 2013; 19:2187-2195.
Table 1. Primer sequences used to amplify USH2A exons 20 and 70 from gDNA samples.
| Primer Name | Sequence (5′-3′) | Tm (°C) | Direction | Amplicon Length (bp) |
|---|---|---|---|---|
| USH2A Ex20-F | TCCTAATGGTGGTTGGCAAT | 60 | Sense | 382 |
| USH2A Ex20-R | AGTGAGGGAGGAGAAGACAAA | 58 | Antisense | 382 |
| USH2A Ex70-F | CTACAGCGAGCTGTGGTTCA | 60 | Sense | 362 |
| USH2A Ex70-R | GCAGCCAAAGTTGAGAAAGC | 60 | Antisense | 362 |