Table 1 of
Chiras, Mol Vis 2013; 19:1006-1016. Table 1 of
Chiras, Mol Vis 2013; 19:1006-1016.
Table 1. Sequences of LOXL1 primers and probes used for either the separate or the combined assays developed for the detection of R141L and G153D SNPs.
| Name | Oligonucleotide sequence | Tm (°C) | GenBank genomic location NG_011466 |
|---|---|---|---|
| Common Forward primer, LOXL1F | TCAACTCGGGCTCAGAGTACG | 59,0 | 501–521 |
| Common Reverse primer, LOXL1R | CGGTAGTACACGAAACCCTGGT | 59,9 | 933–954 |
| R141L Anchor | 5′-TGGCCGTCGGGGACAGCACG-FL* | 72,2 | 729–748 |
| Sensor probes | LC705-CATGGCCC
|
64,9 | 789–807 |
| G153D sensor | 5′-ACGGGG
|
66,0 | 751–766 |
| Anchor probes | LC640-GTCTCGGCTTCGGCCTTCGCCAG-3′ | 73,2 | 809–831 |