Table 1 of Chiras, Mol Vis 2013; 19:1006-1016.


Table 1. Sequences of LOXL1 primers and probes used for either the separate or the combined assays developed for the detection of R141L and G153D SNPs.

Name Oligonucleotide sequence Tm (°C) GenBank genomic location NG_011466
Common
Forward primer, LOXL1F TCAACTCGGGCTCAGAGTACG 59,0 501–521
Common
Reverse primer, LOXL1R CGGTAGTACACGAAACCCTGGT 59,9 933–954
R141L Anchor 5′-TGGCCGTCGGGGACAGCACG-FL* 72,2 729–748
Sensor probes LC705-CATGGCCC TGGCCCGC- 3′ 64,9 789–807
G153D sensor 5′-ACGGGG ACTCCGCCTCCTC-FL* 66,0 751–766
Anchor probes LC640-GTCTCGGCTTCGGCCTTCGCCAG-3′ 73,2 809–831