Table 2 of
Wang, Mol Vis 2012; 18:803-815. Table 2 of
Wang, Mol Vis 2012; 18:803-815.
Table 2. Primers used for real-time PCR.
| Gene name | Primer sequence | Probe sequence | Product length |
| p16INK4A | F: cttcctggacacgctggt | gacctggctgaggagctg | 162 bp |
| (NM_000077) | R: gcatggttactgcctctggt | ||
| Bmi1 | F: ccagggcttttcaaaaatga | accagaacagattggatcgg | 271 bp |
| (NM_005180) | R: gcatcacagtcattgctgct | ||
| Ki67 | F: gatcccatttctggggattt | tgaatctcccttttggaagc | 264 bp |
| (NM_002417) | R: ggtctccccctgtaaaccat |