Molecular Vision: Roberts, Mol Vis 2012; 18:280-289. Table 3

Table 3. Information pertaining to the primers designed for AS-PCR for Gly863Ala mutation detection.

Exon (mutation)	Primer name (bp)	Primer length	*Primer sequence (5′-3′)**
17	Gly863Ala-Rc	26	tttttgaagtggggttccatagtcag
	Gly863Ala-Rg	36	gcgtgcttggggtatgaagtggggttccatagtcac

Gly863Ala-Rc: The AS-PCR primer designed specifically to bind to the nucleotide, cytosine (C), when exon 17 does not contain the p.Gly863Ala mutation, and is therefore known as the wild type primer. Gly863Ala-Rg: The AS-PCR primer designed specifically to bind to the nucleotide, guanine (G), when exon 17 contains the p.Gly863Ala mutation, and is therefore known as the mutation-specific primer. *The nucleotide sequence in bold is the sequence designed to bind complementary to the genomic DNA sequence. The nucleotide sequence not written in bold is the random nucleotide tail added to the primer sequence.