Table 2 of
Roberts, Mol Vis 2012; 18:280-289. Table 2 of
Roberts, Mol Vis 2012; 18:280-289.
Table 2. Information pertaining to the primers designed for the snapshot multiplex reaction.
Exon (mutation) |
Primer length (bp) with tail |
Primer sequence (with tail, 5′-3′)* |
|---|---|---|
| 13 (p.Arg602Trp) | 34 | R: tgttccagtgccacgaacccgccccagatgtacc |
| 30 (p.Cys1490Tyr) | 32 | R: cttcgtggttactgagcttctccctggtgctg |
| 39 (Intron 38) (c.5461–10T>C) | 37 | F: ccgatgtagttgaccccgtttccaacagtcctacttc |
| 44 (p.Leu2027Phe) | 41 | R: tactctggatcttagtaggtaaagatgttctcgtcctgtga |