Table 1 of
Roberts, Mol Vis 2012; 18:280-289. Table 1 of
Roberts, Mol Vis 2012; 18:280-289.
Table 1. Information pertaining to the primers used to amplify the exons containing the seven most common ABCA4 mutations.
Exon (mutation) |
Primer 5′-3′ |
Annealing temperature |
Mutation detection technique |
|---|---|---|---|
| Exon 5 (p.Arg152*) | F: gacccatttccccttcaac | 60 °C | dHPLC, Cycle sequencing using the reverse primer |
| R: aggctgggtgcttccctc | |||
| Exon 6 (c.768G>T) | F: ggtgtctttcctaccacag | 57.9 °C | dHPLC, Cycle sequencing using the forward primer |
| R: aggaatcaccttgcaattgg | |||
| Exon 13 (p.Arg602Trp) | F: agctatccaagcccgttcc | 63 °C | SNaPshot PCR |
| R: ccattagcgtgtcatggag | |||
| Exon 17 (p.Gly863Ala) | F: ctgcggtaaggtaggataggg | 60 °C | Allele-specific PCR |
| R: cacaccgtttacatagagggc | |||
| Exon 30 (p.Cys1490Tyr) | F: gtcagcaactttgaggctg | 63 °C | SNaPshot PCR |
| R: tccctctgtggcaggcag | |||
| Intron38/Exon39 (c.5461–10T>C) | F: gccccacctgctgaagag | 63 °C | SNaPshot PCR |
| R: tcccagctttggacccag | |||
| Exon 44 (p.Leu2027Phe) | F: gaagcttctccagccctagc | 63 °C | SNaPshot PCR |
| R: tgcactctcatgaaacaggc |