Table 1 of Wang, Mol Vis 2011; 17:3290-3299.


Table 1. Primers used for genotyping

SNP Direction Primer sequence (5′-3′)
rs2839471 F TGGGGCTGCAGGTGTTGTG
  R AGTGGGCCAGCTAGGAAAAGAAA
rs577948 Nest-F CACAATGCAAAGGATCAGAGC
  Nest-R AGCGTGATCAGAATACAAGATGG
  F-A ACTGTCAGAAACTCAACTCTCA
  F-G TATAACTGTCAGAAACTCAACTCTCG
  R-Pub+M13 CGTTGTAAAACGACGGCCAGTatcagaatacaagatggagcgtagg
rs11218544 Nest-F GCAAAGGAAACAATCAACAGAG
  Nest-R AAAGGTGTCCAAATGATAGCC
  F-T CAAATCACTAACCTTTCCAGAACAT
  F-G TATACAAATCACTAACCTTTCCAGAACAG
  R-Pub+M13 CGTTGTAAAACGACGGCCAGTggaccaaagacagctcaaacc
M13 probe   FAM-CGTTGTAAAACGACGGCCAGT