Table 2 of
Gu, Mol Vis 2011; 17:3200-3207. Table 2 of
Gu, Mol Vis 2011; 17:3200-3207.
Table 2. Primers designed for sequencing of the TGFBI gene.
| Primer for exon |
Forward |
Reverse |
Length (bp) |
|---|---|---|---|
| 1 | caggaggcctaagggaccta | ctccatgctgcaaggttttt | 607 |
| 2 | tcaattgcccatgtcaaaga | gccctgaaaaatgtctccaa | 607 |
| 3 | ccagttggttggctgtaggt | gaggagcagctcaggaaatg | 514 |
| 4 | ccccagaggccatccctcct | ccgggcagacggaggtcatc | 358 |
| 5 | ggcatgatgaatgggagtct | gagaagcaggcacaaagagg | 579 |
| 6 | tctccttgggccctctatt | tcaggggaacctgctctatg | 416 |
| 7 | aggaagaggaaaggcaggtt | agcaacaggacaggatgacc | 532 |
| 8 | agaaggcgaggaggatctg | gtcacaacccacacatttgc | 527 |
| 9 | tgactgttcccctgatgaca | ttttggttgagctgagtgga | 434 |
| 10 | ttggcagcttcacttggttt | ttccttccttgtcagcaacc | 409 |
| 11 | tcccagccttaataacccatc | cttttccccatcccaagtct | 433 |
| 12 | tccagtggcctggactctac | gatgtgccaactgtttgctg | 337 |
| 13 | tgctttgtgtcctctgacca | catcctgggggtgagatatg | 402 |
| 14 | ggcgacaagattgaaactcc | cccaattcactctgcaatca | 405 |
| 15 | tgtgcattcacctttcttgg | agtgggagtggggagaagtt | 406 |
| 16 | gtccacctgaaggcacactt | ccaagtcaccctgctgttct | 393 |
| 17 | cacctgctatgtgcaggaga | ggctggattgcttgattcat | 532 |