Table 1 of Hu, Mol Vis 2011; 17:1334-1342.


Table 1. Primers used for reverse transcription-PCR amplification of human integrin subtypes.

Gene
product
GenBank
accession

Forward primer (5′-3′)

Reverse primer (5′-3′)
Product
size (bp)
integrin α1 NM_181501.1 TCAAACGAGGCACAATTCTG AGCAGGATGACCCATAATGG 280
integrin α2 NM_002203.3 GCCTTGCCTTAGGTAATCAG CCAGGAATGCTGCTAAACAT 226
integrin β1 NM_033668.2 GAAAGACACATGCACACAGGAA ACATGAACCATGACCTCGTTGT 180