Table 1 of Chee, Mol Vis 2010; 16:800-812.
Table 1. Specific NKCC and NCC PCR primer sets.
Isoform |
Accession number |
Oligonucleotide |
Expected product size (bp) |
Thermocycling Conditions |
|---|---|---|---|---|
| NKCC1 | AF051561 | Sense, position #917; GTCACATACACTGCCGAAAG Antisense, position #1247; TCTGCGATTCCAACAACATA | 350 | 35 cycles of: 94 °C for 30 s; 52.7 °C for 30 s; 72 °C for 30 s |
| NKCC2 | RNU10096 | Sense, position #2731; CCGCAATCAAAGACAACGAC Antisense, position #3219; CTAAACTGGTGACGACTCTT | 508 | 40 cycles of: 94 °C for 30 s; 52.7 °C for 30 s; 72 °C for 30 s |
| NCC | RNU10097 | Sense, position #520; TGGCTCATCATCCTGCTGTC Antisense, position #926; GGCTTTGTCCTTAGATGCTG | 406 | 35 cycles of: 94 °C for 30 s; 65.3 °C for 30 s; 72 °C for 30 s |