Table 7 of Goldstein, Mol Vis 2010; 16:1549-1569. Table 7 of Goldstein, Mol Vis 2010; 16:1549-1569.
Table 7. Genomic PCR primers. Primer pairs, sequences, location and observed product sizes in normal, crd3-carrier, and crd3-affected DNA, used in multiplex analysis. NO=not observed.
Primer pair |
Forward primer name |
Forward primer sequence |
Forward primer location |
Reverse primer name |
Reverse primer sequence |
Reverse primer location |
Observed size from normal dog (bp) |
Observed size from crd3-carrier dog (bp) |
Observed size from crd3-affected dog (bp) |
|---|---|---|---|---|---|---|---|---|---|
| 1 | F10 | tctaaaatggaggaagtgtgaactaca | Intron 15 | R10 | ttcttggcttgggctaactct | Intron 15 | 602 | 602 | NO |
| 2 | F29 | ctggagcaatggggctggata | Intron 14 | R31 | tcaaaggagcaatcggaaaagtct | Intron 16 | NO (>24 Kb) | 1515 | 1515 |