Table 4 of Goldstein, Mol Vis 2010; 16:1549-1569.
Primer pair |
Forward primer name |
Forward primer sequence |
Forward primer location |
Reverse Primer name |
Reverse primer sequence |
Reverse primer location |
Observed size in normal (bp) |
Observed size in affected (bp) |
---|---|---|---|---|---|---|---|---|
A. Initial sequencing of the region. | ||||||||
1 | deletion_F1 | CGAGGAAAAACCAACGAATGTGAT | Exon 14 | deletion_R1 | gagcaagcaatgaaaatagcagacc | Intron 14 | 521 | 521 |
2 | deletion_F2 | cctacctaataaccccatcccttgg | Intron 14 | deletion_R2 | tcagaaccctatccttttggcttg | Intron 14 | 627 | 627 |
3 | deletion_F3 | ctctgtgagtgaggtggacttagc | Intron 14 | deletion_R3 | ccaaggaatgaaacataaaatggaa | Intron 14 | 691 | NO |
4 | deletion_F4 | gagccagtagggagaggaacatca | Intron 14 | deletion_R4 | aaagacgcagaggaccacacaac | Intron 14 | 691 | NO |
5 | deletion_F5 | caagaatagtttgctaccttgtcagc | Intron 14 | deletion_R5 | ataccctggatcaactgccacatt | Intron 14 | 612 | NO |
6 | deletion_F6 | tgggtgttatgttcttcttgctca | Intron 15 | deletion_R6 | gaatgtgtagaggggcagagg | Intron 15 | 610 | NO |
7 | deletion_F7 | tcttagcagagccagagagccttc | Intron 15 | deletion_R7 | cagtttatccttccttcaacattcacg | Intron 15 | 622 | NO |
8 | deletion_F8 | atttggtggtcaacattcattggt | Intron 15 | deletion_R8 | cattcaaaacaactggaagcaggt | Intron 15 | 611 | NO |
9 | deletion_F9 | acgctgttgtgcagatcgtactgt | Intron 15 | deletion_R9 | aaccgtgagatgaaacatttgtgg | Intron 15 | 999 | NO |
10 | deletion_F10 | tctaaaatggaggaagtgtgaactaca | Intron 15 | deletion_R10 | ttcttggcttgggctaactct | Intron 15 | 602 | NO |
11 | deletion_F11 | tgtctgtccacgctctctgctatc | Intron 16 | deletion_R11 | tctctctacctctccctctgtttcca | Intron 16 | 688 | NO |
12 | deletion_F12 | ttgttacccgccataccccttgt | Intron 16 | deletion_R12 | ggagcaaagatgaaaaatacaggaa | Intron 16 | 759 | NO |
13 | deletion_F13 | ggaacaaacgcctctctcagtctt | Intron 16 | deletion_R13 | accagtagtccaaagggtccaggt | Intron 16 | 795 | NO |
14 | deletion_F14 | gaaatggtggggtggtagacaaga | Intron 16 | deletion_R14 | tactggggaaagatgagggttttt | Intron 16 | 774 | NO |
15 | deletion_F15 | tgactgtgaggggaagtgaagagtt | Intron 16 | deletion_R15 | cgttgaatgatggtatttggagatga | Intron 16 | 805 | NO |
16 | deletion_F16 | tgtcttctgttttggttgccagtg | Intron 16 | deletion_R16 | ccccgaactcatcccttactttct | Intron 16 | 835 | NO |
17 | deletion_F17 | acacatccccattccaactttcag | Intron 16 | deletion_R17 | accatcaactctcctggctctcag | Intron 16 | 796 | 796 |
18 | deletion_F18 | agcaccctcacaaacattcaga | Intron 16 | deletion_R18 | tcctctcaggcttttaccattatctt | Intron 16 | 798 | 798 |
19 | deletion_F19 | gaaaggaagtgtttgctgtagggaaa | Intron 16 | deletion_R19 | tctggatgaggtgagagtgaatgg | Intron 16 | 729 | 729 |
20 | deletion_F20 | aagattgaccgcttttcaccta | Intron 16 | deletion_R20 | ctacagatggctttgggcagtatg | Intron 16 | 718 | 718 |
21 | deletion_F21 | atccaggggaaatgaaaacaggag | Intron 16 | deletion_R21 | ggctgagagagcagaccagattgt | Intron 16 | 787 | 787 |
22 | deletion_F22 | tgagaagacaaatgaggggcactt | Intron 16 | deletion_R22 | tcaaaccaggcaatcaaacacctt | Intron 16 | 822 | 822 |
23 | deletion_F23 | cagaaggtgtttgattgcctggtt | Intron 16 | deletion_R23 | ttttgtttcccacagcatttttga | Intron 16 | 769 | 769 |
24 | deletion_F24 | tgctgatttctcccattattacca | Intron 16 | deletion_R24 | cacagttcctacaccaccaccaac | Intron 16 | 739 | 739 |
25 | deletion_F25 | aacttcatctaccctccttcacttg | Intron 16 | deletion_R25 | agtctcacctacctcactgggaat | Intron 17 | 752 | 752 |
B. Refined sequencing of the region. | ||||||||
26 | deletion_F26 | caagccaaaaggatagggttctga | Intron 14 | deletion_R26 | tcactccacaggtaaaaagccaaga | Intron 14 | 459 | 459 |
27 | deletion_F27 | tgactgaacccaggaagagagttg | Intron 14 | deletion_R27 | tgaatgaacaggcgaaaaagagag | Intron 14 | 462 | 462 |
28 | deletion_F28 | acctggattgggtttctttagg | Intron 14 | deletion_R28 | gcccgtggagtgggacataacta | Intron 14 and Intron 16 | 487 | 487 |
29 | deletion_F29 | ctggagcaatggggctggata | Intron 14 | deletion_R29 | aaaccaaaagcaataaataccacaa | Intron 14 and Intron 16 | 649 | 649 |
30 | deletion_F30 | atcagtcgttgagggtgacattga | Intron 14 and Intron 16 | deletion_R30 | ccgtggaaaagaaaaatcagacct | Intron 14 and Intron 16 | 421 | 421 |
31 | deletion_F31 | gggaaggatgggagaatgagagta | Intron 14 and Intron 16 | deletion_R31 | tcaaaggagcaatcggaaaagtct | Intron 16 | 476 | 476 |
32 | deletion_F32 | aaagggaaagggagggacagact | Intron 16 | deletion_R32 | tgtgagataaaggaaaataaagttgga | Intron 16 | 658 | 658 |
33 | deletion_F33 | cacaggctaacttttgctccatgt | Intron 16 | deletion_R33 | tgagtcttccttgccagtagaagc | Intron 16 | 479 | 479 |
34 | deletion_F29 | ctggagcaatggggctggata | Intron 14 | deletion_R31 | tcaaaggagcaatcggaaaagtct | Intron 16 | NO | 1,515 |