Table 1 of Krishnan, Mol Vis 2010; 16:1169-1177.


Table 1. Primer sequence and reaction condition for RT–PCR.



Gene


Primer sequence (3′-5′)
Annealing
temperature
(°C)
PCR product
size
(bp)
ABCG2 FP:AGTTCCATGGCACTGGCCATA 62 379
  RP:TCAGGTAGGCAATTGTGAAGG    
ΔNp63 FP:CAGACTCAATTTAGTGAG 54 440
  RP:AGCTCATGGTTGGGGCAC    
Connexin 43 FP:CCTTCTTGCTGATCCAGTGGTAC 66 154
  RP:ACCAAGGACACCACCAGCAT    
Keratin3 FP: GGCAGAGATCGAGGGTGTC 64 145
  RP: GTCATCCTTCGCCTGCTGTAG    
Keratin12 FP:CATGAAGAAGAACCACGAGGATG 63 150
  RP:TCTGCTCAGCGATGGTTTCA    
GAPDH FP:GCCAAGGTCATCCATGACAAC 63 498
  RP:GTCCACCACCCTGTTGCTGTA