Molecular Vision: Gu, Mol Vis 2009; 15:2111-2122. Table 2

Table 2. Primers used for quantitative RT–PCR

Genes	Description	Accession number	Forward (5′-3′)	Reverse (5′-3′)
Nestin	Intermediate filament, progenitor	NM_016701	aactggcacctcaagatgt	tcaagggtattaggcaagggg
Vimentin	Intermediate filament, progenitor	NM_011701	tggttgacacccactcaaaa	gcttttggggtgtcagttgt
Sox2	Transcription factor, progenitor	NM_011443	cacaactcggagatcagcaa	ctccgggaagcgtgtactta
Hes1	Transcription factor, progenitor	NM_008235	cccacctctctcttctgacg	aggcgcaatccaatatgaac
Hes5	Transcription factor, progenitor	NM_010419	caccgggggttctatgatatt	caggctgagtgctttcctatg
Pax6	Transcription factor, progenitor	NM_013627	agtgaatgggcggagttatg	acttggacgggaactgacac
Chx10	Transcription factor, progenitor	NM_007701	caatgctgtggcttgcttta	cttgagagccactgggctac
Mash1	Transcription factor, progenitor	NM_008553	tctcctgggaatggactttg	ggttggctgtctggtttgtt
Notch1	Surface receptor, progenitor	NM_008714	acccactctgtctcccacac	gcttccttgctaccacaagc
K_i-67	Cell cycle protein, proliferation	X82786	cagtactcggaatgcagcaa	cagtcttcaggggctctgtc
β3-tubulin	Microtubule protein, neural precursor	NM_023279	cgagacctactgcatcgaca	cattgagctgaccagggaat
DCX	Microtubule-associated, neuroblast	NM_010025	tgtaaactaaaacaaagacccgaag	aagtacctcacaagtcaaagaatgg
Map2	Microtubule-associated, neuron	NM_001039934	agaaaatggaagaaggaatgactg	acatggatcatctggtaccttttt
Recoverin	Phototransduction-related, retinal cells	NM_009038	atggggaatagcaagagcgg	gagtccgggaaaaacttggaata
Rhodopsin	Phototransduction, rod photoreceptor	NM_145383	tcaccaccaccctctacaca	tgatccaggtgaagaccaca
PKC-α	Bipolar neuron	NM_011101	cccattccagaaggagatga	ttcctgtcagcaagcatcac
CRALBP	Müller, RPE cell	NM_020599	agggtctttgttcacggagat	tgccactagagcgttcctaaa
GFAP	Intermediate filament, glia	NM_010277	agaaaaccgcatcaccattc	tcacatcaccacgtccttgt
β-actin	Housekeeping gene	NM_007393	agccatgtacgtagccatcc	ctctcagctgtggtggtgaa

Primer pairs were selected to evaluate an expression profile of 19 different murine genes. In addition to housekeeping, these included genes associated with progenitor status and proliferation, as well as neuronal, glial, and retinal lineages. This was done to enable quantitative monitoring of the relative expression levels of primitive versus mature markers, thereby allowing comparison of the relative differentiating influence of the culture conditions examined. Gene name abbreviations: Sox represents sex determining region Y-box, Hes represents hairy and enhancer of split, Pax represents paired box, Chx represents Ceh-10 homeodomain containing homolog, Mash represents mammalian achaete-scute homolog, DCX represents doublecortin, Map represents microtubule-associated protein, PKC represents protein kinase C, CRALBP represents cellular retinaldehyde binding protein.