Table 2 of Szaflik,
Mol Vis 2008; 14:1713-1718. Table 2 of Szaflik,
Mol Vis 2008; 14:1713-1718.
Table 2. KRT3 and KRT12 genotypes and symptoms in patients with MCD.
| Gene/exon | Nucleotide | Protein | Ocular symptoms | Reference | |
|---|---|---|---|---|---|
| KRT3 | |||||
| exon 7 | 1493A>T | E498V | asymptomatic | present study | |
| exon 7 | 1508G>C | R503P | foreign body sensation, mild blurred vision | [6] | |
| exon 7 | 1525G>A | E509K | - | [4] | |
| KRT12 | |||||
| exon 1 | 410T>C | M129T | - | [14,15] | |
| exon 1 | 413A>C | Q130P | recurrent painful erosions, foreign body sensation, photophobia, lacrimation, blurred vision | [16] | |
| exon 1 | 423A>G | N133K | soreness of both eyes; deterioration in visual acuity | [17] | |
| exon 1 | 427A>G | R135G | photophobia, lacrimation, itching | [18] | |
| exon 1 | 428G>T | R135I | photophobia, lacrimation, itching | [18] | |
| exon 1 | 428G>C | R135T | - | [4,14] | |
| exon 1 | 429A>C | R135S | post-traumatic recurrent erosion | [13] | |
| exon 1 | 433G>C | A137P | photophobia | [19] | |
| exon 1 | 443T>G | L140R | photophobia, lacrimation, itching | [18] | |
| exon 1 | 451G>C | V143L | - | [4] | |
| exon 1 | 451G>T | V143L | asymptomatic | [20] | |
| exon 6 | 1222+ATCAGCAACCTGGAGGCACAGCTGCTC | 400 ins ISNLEAQLL | recurrent erosions, foreign body sensation, photophobia, fluctuating vision, contact lens intolerance | [13] | |
| exon 6 | 1300A>G | I426V | asymptomatic | [21] | |
| exon 6 | 1301T>G | I426S | photophobia | [15] | |
| exon 6 | 1286A>C | Y429D | photophobia, lacrimation, itching | [18] | |
| exon 6 | 1286A>G | Y429C | recurrent erosions, foreign body sensation, photophobia, lacrimation, fluctuation of visual acuity | [6] | |
| exon 6 | 1289G>C | R430P | symptoms from birth; photophobia, lacrimation, periodic burning, irritation, significant impairment of visual acuity | [7] | |