Table 1 of Kim, Mol Vis 2008; 14:1487-1495.


Table 1. Primers Used

Location Forward primer Reverse primer
5′-UTR/promoter TTTACTGTCAGGGCCGTCAT TCTCTCAGGGCTCCACTTTG
Exon 1, Intron 1 TCTTCCCGAAGCTCTGACAC ACACACACCATGAAGGATGC
Exon 2 (part 1) GTGTAACTGGAGAAGGGGTCA CTTCTGCCCCCACAGTGTAT
Exon 2 (part 2) TACAGTGGGTGG GTCTGAAA TGGGAACCATGCAGTGTAAA
3′-UTR GCCCTTCAGTCCTAATGTCC AGATCAGCGCTTCCTTCTCA
3′ UTR TGGTTTTTG TTTGCTTGCAG TGGGCAGTCCAGGTGTAGAT