\set{final} \def\Author{Hansen} \def\author{hansen} \def\vol{13} \def\year{2007} \def\anum{227} \def\pages{2019-2022} \def\txt_title{Novel MAF mutation in a family with congenital cataract-microcornea syndrome} \def\txt_authors{Lars Hansen, Hans Eiberg, Thomas Rosenberg} \def\rcvd{30 August 2007} \def\accept{16 October 2007} \def\publ{18 October 2007} \def\pdfsize{} \def\GalleyQCount{1} \def\PMID{} \include{mvstyle.hsm} \| External links \def\kennedy{http://www.kennedy.dk} \def\ncbi{http://genome.ucsc.edu} \| Internal defs \article{ \title{Novel \i{MAF} mutation in a family with congenital cataract-microcornea syndrome} \authors{\mailto{larsh@imbg.ku.dk}{Lars Hansen},\sup{1,2} \mailto{he@imbg.ku.dk}{Hans Eiberg},\sup{2} \mailto{tro@kennedy.dk}{Thomas Rosenberg}\sup{3}} \institutions{\sup{1}The Wilhelm Johannsen Center for Functional Genome Research and \sup{2}Department of Cellular and Molecular Medicine, The Panum Building, University of Copenhagen, Copenhagen N, Denmark; \sup{3}Gordon Norrie Center for Genetic Eye Diseases, National Eye Clinic, Kennedy Center, Hellerup, Denmark} \correspondence{Lars Hansen, Department of Cellular and Molecular Medicine, The Panum Building, University of Copenhagen, 3b Blegdamsvej, DK-2200, Copenhagen N, Denmark; Phone: +45 35327809; FAX: +45 35327845; email: larsh@imbg.ku.dk} \abstract \abs_purpose{To further unravel the molecular genetic background for the association congenital cataract-microcornea (CCMC).} \abs_methods{DNA variation was pointed out by direct DNA sequencing of 13 lens-expressed cataract genes from three CCMC families and one isolated case. The mutation screening included seven crystalline genes, two gap junction protein genes, and four lens expressed regulatory genes.} \abs_results{A DNA variation in the basic leucine zipper transcription factor V-maf musculoaponeurotic fibrosarcoma oncogene homolog gene (\i{MAF}) was identified in one family. The mutation c.895C\gt A changes arginine 299 to a serine residue, and the substitution destroys the basic region of the DNA binding domain of MAF leucine-zipper. Mutations were not identified in the remaining CCMC patients.} \abs_conclusions{One novel mutation affecting a known cataract gene was identified among four unrelated individuals with presumed autosomal dominant congenital cataract-microcornea syndrome. The \i{MAF} mutation p.Arg299Ser is the third mutation identified in association with the CCMC phenotype, and all three mutations are located in the basic region of the DNA binding domain in the MAF protein (OMIM 177075). This suggests that the basic region is a hot spot domain for CCMC associated mutations. The identification of a novel mutation associated with the distinct cataract-microcornea phenotype adds a new brick to the puzzle of molecular modeling of the lens-anterior segment structures.} \introduction \p{Congenital/infantile cataracts show considerable clinical and locus heterogeneity. The association of congenital cataract and microcornea (CCMC), cataract-microcornea syndrome, OMIM \omim{116150} appears as a distinct phenotype affecting 12%-18% of heritable congenital cataract cases [1]. Genetically, CCMC is a heterogeneous condition. Eleven different mutations in five known congenital cataract genes have been described in 13 CCMC families [1]. The genes include three of the lens specific crystallins (\i{CRYAA}, \i{CRYBB1}, and \i{CRYGD}), the gap junction protein (\i{GJA8}), and the basic leucine zipper transcription factor, \i{MAF}. Only the transcription factor, \i{MAF}, has exclusively been associated with CCMC whereas mutations in the other four genes are reported in congenital cataract without additional malformations as well [1].} \p{Whether the CCMC phenotype is related to specific cataract gene alleles or closely linked modifiers remains to be clarified. Here, we report one novel mutation as a part of a larger study of hereditary congenital cataract [1,2].} \methods \p{Patients were retrieved from a registry of hereditary eye diseases at The National Eye Clinic, \hot{\kennedy}{Kennedy Center}, formerly The National Eye Clinic for the Visually Impaired (NEC). Three small families (CCMC0107, CCMC0110, and CCMC0112) with presumed autosomal dominant transmission and a nonfamilial case (CCMC4001) with the CCMC phenotype were included in the study. Blood samples were provided from one individual in each of two families and from six individuals in family CCMC0112. Microcornea was defined as a horizontal corneal diameter below 11 mm in individuals aged seven years or older. At the time of this study, most patients were either aphakic or had artificial lenses inserted. Therefore, cataract phenotypes were retrospectively obtained from the patient files at NEC.} \p{The study adhered to the tenets of the declaration of Helsinki and was approved by the Copenhagen Scientific Ethical Committee. All subjects gave their informed written consent to participate in the study.} \p{Genomic DNA was extracted from whole blood using standard procedures, and screenings for mutations in 152 unrelated normal people were done using individuals selected from the Copenhagen Family Bank [3].} \p{Direct DNA sequencing was performed using BigDye version 1.1 sequencing technology and an ABI 3130 sequencing apparatus (Applied Biosystem, Foster City, CA). Polymerase chain reaction (PCR) and sequencing primers (primer sequences and amplification conditions for \i{MAF} are presented in \tabref{1}, primer sequences and amplification conditions for the remaining genes are available on request) were designed using the software program Primer 3 [4] and purchased from TAG Copenhagen A/S (Copenhagen, Denmark). All exons and exon/intron border regions were bidirectionally sequenced and aligned to the GenBank reference sequences. The following genes were included in the DNA sequencing analysis: \i{CRYAA}, \genbankdna{NM_000394}; \i{CRYBA1}, \genbankdna{NM_005208}; \i{CRYBB1}, \genbankdna{NM_001887}; \i{CRYBB2}, \genbankdna{NM_000496}; \i{CRYBB3}, \genbankdna{NM_004076}; \i{CRYGC}, \genbankdna{NM_020989}; \i{CRYGD}, \genbankdna{NM_006891}; \i{GJA3}, \genbankdna{NM_021954}; \i{GJA8}, \genbankdna{NM_005267}; \i{MIP}, \genbankdna{NM_012064}; \i{BFSP2}, \genbankdna{NM_003571}; \i{HSF4,} \genbankdna{NM_001538}; and \i{MAF}, \genbankdna{NM_005360}. Genomic intron sequences were aligned to human reference assembly hg17 (\hot{\ncbi}{NCBI Build 36.1} from UCSC). Taq DNA polymerases were purchased from New England BioLab (Ipswich, MA), Qiagen (Hilden, Germany), or Invitrogen (Carlsbad, CA). Reactions were performed in 15 \mu l volumes according to the manufactures' protocols. PCR reactions were analyzed by 2% agarose gel-electrophoresis by staining with ethidiumbromide, 1X TBE, before sequencing. Sequence analyses were performed using the software ChromasPro (Technelysium Pty Ltd, Tewantin, Australia). One individual from each of the four CCMC families was chosen for DNA sequencing of the 13 cataract candidate genes.} \p{Identified mutations were analyzed by restriction enzyme digests; restriction enzymes were purchased from New England BioLab (Ipswich, MA), and digests were performed according to the manufacturer's protocols in a reaction volume of 20 \mu l, using 2-4 \mu l PCR product and 2-5 units of the enzyme. The digested PCR products were analyzed by 2% agarose, 1X TBE, and DNA visualized by staining with ethidiumbromide.} \results \subsection{Mutation} \p{Direct DNA sequencing of \i{MAF} (V-MAF avian musculoaponeurotic fibrosarcoma oncogene homolog) revealed the nucleotide variation c.895C\gt A in family CCMC0112 (\figref{1}{A,B}). The variation changes arginine 299 into serine, p.Arg299Ser (\figref{2}{A}). Use of the restriction enzyme, \i{Sac}II, digestion confirmed the mutant allele and the wild type allele in the four affected family individuals (I:1, II:1, III:1, and III:2) and the wild type allele only in the two unaffected individuals (I:2 and II:2, \figref{1}{C}). One hundred and fifty-two normal and unrelated individuals did not exhibit the nucleotide change (data not shown).} \subsection{Phenotypes} \p{By history, the eldest affected, I:1 in family CCMC0112 (\figref{1}{A}), had congenital cataract, which was not operated until she was 47 years old. In II:1, a dense posterior polar opacity was diagnosed when she was five months old, but due to a sufficient visual acuity, operation was postponed until she was 21 years of age. Her corneal diameters were 10 mm, and an iris coloboma was present in the right eye. Refractive values were -5.0 D and -3.5 D. At birth, both children had nuclear cataracts, which in III:1 was described as dense zonular (lamellar) and in III:2 as star-shaped. They underwent cataract aspiration at three and one months old, respectively. Their corneal diameters were 9.5 mm and none of them had iris anomalies. Nystagmus was only noted in patient III:2. Keratometer readings were 47.25/45.94 D and axial lengths 20.7/21.2 mm in the right and left eye, respectively, in patient III:1 at the age of two and a half years. The corresponding values in patient III:2 were 19.23/18.39 D and 22.5/22.8 mm at the age of two months (right and left eye, respectively).} \discussion \p{In addition to the p.Arg299Ser mutation described in this paper, two other CCMC-causing MAF mutations, p.Arg288Pro and p.Lys297Arg, are known in humans [5-7]. They are all located in the basic region of the DNA binding domain of the transcription factor (\figref{2}). MAF is one out of seven human basic leucine zipper proteins and belongs to the group of large bZIP MAF proteins. These proteins are involved in eye and lens development from the formation of the lens pre-placode to development of the lens-fiber cells and lens-epithelium. The MAF proteins are involved in regulation of both \alpha-, \beta-, and \gamma- crystallins, \i{MIP}, and other genes expressed in the lens fiber cells [8-10]. Besides the COOH-terminal bZIP DNA binding domain, the large MAF protein contains a NH\sub{2}-terminal putative activation domain rich in proline, serine, and threonine as well as a hinge region with an unknown function (\figref{2}). The nomenclature of MAF varies for different organisms and human \i{MAF} is synonymous to c-\i{MAF}. Phylogenetic analysis of \i{MAF} reveals both gene duplications and expressional conservation for the different \i{MAF} genes [11]. DNA recognition sequences (MARE - Maf recognition element, TGC TGA (G/C)TC AGC A and TGC TGA (GC/CG)T CAG CA) are present in several crystallin promoters as well as in other genes [9,12].} \p{The three MAF mutations associated with CCMC are located in the same \alpha-helix structure of the regulatory domain, suggesting the \alpha-helix 3 (\figref{2}{B}) as a mutational hot spot for the congenital cataract-microcornea phenotype and occasionally in association with iris coloboma. Functional in vitro experiments in cell lines on the effect of the MAF mutation, p.Arg288Pro, on the chicken \gamma F-crystallin promotor showed that the mutation eliminated the transcriptional activity of MAF without any detectable effect on its DNA binding affinity or specificity [13]. In contrast to the wild type protein that is uniformly distributed in the nucleus, the mutant p.Arg288Pro protein is localized in the nuclear foci [13]. It seems likely that a similar pathogenetic effect is responsible for the two other CCMC mutations, p.Arg299Ser and p.Lys297Arg, in the same functional and structural Maf domain (\figref{2}).} \p{Two Maf mutations are known in mouse [14,15]. One, p.Arg291Gln, is located in the basic \alpha-helix 3 domain and results in the same inhibitory effect on transcription as found for the human MAF mutation. The second mutation, p.Asp90Val, is located in the acidic activation domain and results in a mild pulverulent cataract named 'opaque flecks', which when bred on different genetic backgrounds, also show anterior segment abnormalities in heterozygotes [15]. Opposite to the functional consequences of the p.Arg288Pro mutation, p.Asp90Val demonstrate an enriched transcriptional activity on the regulated genes [15]. A study of nul-Maf mice (c.Maf -/- mice) showed that heterozygous c-Maf mice lenses developed normally while mutations in both c-Maf alleles induced incomplete primary fiber cell formation and a lack of secondary fiber cell differentiation [16].} \p{These data together with the genotype/phenotype relations for the three human MAF mutations illustrate the central role of MAF in regulation of downstream genes in the embryo lens development.} \acknowledgements \p{We thank the family for their participation. Maria Jorgensen and Annemette Mikkelsen gave excellent technical assistance. The Wilhelm Johannsen Center for Functional Genome Research (WJC) and the Genome Group/RC-LINK hosted the molecular part of the project. The project was supported by grants from The Danish Association of the Blind and The Danish Eye Health Society. RC-Link is supported by The Danish Medical Research Council, and WJC was established by the Danish National Research Foundation.} \references \p{1. Hansen L, Yao W, Eiberg H, Kjaer KW, Baggesen K, Hejtmancik JF, Rosenberg T. Genetic heterogeneity in microcornea-cataract: five novel mutations in CRYAA, CRYGD, and GJA8. Invest Ophthalmol Vis Sci 2007; 48:3937-44. \pubmed{17724170}} \p{2. Hansen L, Yao W, Eiberg H, Funding M, Riise R, Kjaer KW, Hejtmancik JF, Rosenberg T. The congenital "ant-egg" cataract phenotype is caused by a missense mutation in connexin46. Mol Vis 2006; 12:1033-9 \mvref{12}{116}. \pubmed{16971895}} \p{3. Eiberg H, Nielsen LS, Klausen J, Dahlen M, Kristensen M, Bisgaard ML, Moller N, Mohr J. Linkage between serum cholinesterase 2 (CHE2) and gamma-crystallin gene cluster (CRYG): assignment to chromosome 2. Clin Genet 1989; 35:313-21. \pubmed{2758686}} \p{4. Rozen S, Skaletsky HJ. Primer3 on the WWW for general users and for biologist programmers. In: Misener S, Krawetz SA, editors. Bioinformatics Methods and Protocols. Totowa (NJ): Humana Press; 2000. p. 365-86.} \p{5. Jamieson RV, Perveen R, Kerr B, Carette M, Yardley J, Heon E, Wirth MG, van Heyningen V, Donnai D, Munier F, Black GC. Domain disruption and mutation of the bZIP transcription factor, MAF, associated with cataract, ocular anterior segment dysgenesis and coloboma. Hum Mol Genet 2002; 11:33-42. \pubmed{11772997}} \p{6. Jamieson RV, Munier F, Balmer A, Farrar N, Perveen R, Black GC. Pulverulent cataract with variably associated microcornea and iris coloboma in a MAF mutation family. Br J Ophthalmol 2003; 87:411-2. \pubmed{12642301}} \p{7. Vanita V, Singh D, Robinson PN, Sperling K, Singh JR. A novel mutation in the DNA-binding domain of MAF at 16q23.1 associated with autosomal dominant "cerulean cataract" in an Indian family. Am J Med Genet A 2006; 140:558-66. \pubmed{16470690}} \p{8. Blank V, Knoll JH, Andrews NC. Molecular characterization and localization of the human MAFG gene. Genomics 1997; 44:147-9. \pubmed{9286713}} \p{9. Reza HM, Yasuda K. Roles of Maf family proteins in lens development. Dev Dyn 2004; 229:440-8. \pubmed{14991699}} \p{10. Reza HM, Urano A, Shimada N, Yasuda K. Sequential and combinatorial roles of maf family genes define proper lens development. Mol Vis 2007; 13:18-30 \mvref{13}{3}. \pubmed{17262012}} \p{11. Coolen M, Sii-Felice K, Bronchain O, Mazabraud A, Bourrat F, Retaux S, Felder-Schmittbuhl MP, Mazan S, Plouhinec JL. Phylogenomic analysis and expression patterns of large Maf genes in Xenopus tropicalis provide new insights into the functional evolution of the gene family in osteichthyans. Dev Genes Evol 2005; 215:327-39. \pubmed{15759153}} \p{12. Yamamoto T, Kyo M, Kamiya T, Tanaka T, Engel JD, Motohashi H, Yamamoto M. Predictive base substitution rules that determine the binding and transcriptional specificity of Maf recognition elements. Genes Cells 2006; 11:575-91. \pubmed{16716189}} \p{13. Lyon MF, Jamieson RV, Perveen R, Glenister PH, Griffiths R, Boyd Y, Glimcher LH, Favor J, Munier FL, Black GC. A dominant mutation within the DNA-binding domain of the bZIP transcription factor Maf causes murine cataract and results in selective alteration in DNA binding. Hum Mol Genet 2003; 12:585-94. \pubmed{12620964}} \p{14. Rajaram N, Kerppola TK. Synergistic transcription activation by Maf and Sox and their subnuclear localization are disrupted by a mutation in Maf that causes cataract. Mol Cell Biol 2004; 24:5694-709. \pubmed{15199128}} \p{15. Perveen R, Favor J, Jamieson RV, Ray DW, Black GC. A heterozygous c-Maf transactivation domain mutation causes congenital cataract and enhances target gene activation. Hum Mol Genet 2007; 16:1030-8. \pubmed{17374726}} \p{16. DePianto DJ, Blankenship TN, Hess JF, FitzGerald PG. Analysis of non-crystallin lens fiber cell gene expression in c-Maf -/- mice. Mol Vis 2003; 9:288-94 \mvref{9}{40}. \pubmed{12835653}} \p{17. Kusunoki H, Motohashi H, Katsuoka F, Morohashi A, Yamamoto M, Tanaka T. Solution structure of the DNA-binding domain of MafG. Nat Struct Biol 2002; 9:252-6. \pubmed{11875518}} \endreferences } \beginfigures \figfile{1}{ \figtitle{1}{Pedigree and mutation analysis of family CCMC0112} \p{\panel{A}: Pedigree CCMC0112 is shown. \panel{B}: DNA sequencing of individual CCMC0112-II:1 shows a C\gt A transition, which results in a substitution of arginine to serine. \panel{C}: Restriction enzyme of CCMC0112, \i{Sac}II digest, demonstrates the mutant allele (36 bp and 371 bp) and the wild type allele (36 bp, 102 bp, and 269 bp) in all affected individuals and only the wild type allele in the two spouses and in one unrelated unaffected person (N). Uncut PCR product (407 bp) is shown together with a 100 bp ladder (M).} \ctr{\jpgimage{1}{500}{862}{86}} } \figfile{2}{ \figtitle{2}{Structure of the human MAF protein and gene} \p{\panel{A} illustrates the schematic representation of the MAF protein and gene structure. The three known mutations in the bZip region are indicated. \panel{B} shows a structural analysis of MafG showing three \alpha-helixes in the bZIP region. The 3D-structure is based on PDB data: 1K1V [17]. All three CCMC mutations involved in CCMC are interfering with helix 3. \panel{C} shows that the protein sequence alignment of the seven human MAF proteins reveals extreme high conservation in the EHR and BR element. (The protein accession numbers are: Maf, \genbankprot{NP_005351}; MafA \genbankprot{NP_963883}; MafB, \genbankprot{NP_005452}; MafF, \genbankprot{NP_690617}; MafK, \genbankprot{NP_002351}; MafG, \genbankprot{NP_002350}; Nrl, \genbankprot{NP_006168}).} \ctr{\gifimage{2}{900}{464}{92}} } \begintables \tabfile{1}{ \tabtitle{1}{PCR primer sequences and PCR conditions} \p{Listed are each of the primer pairs used for PCR amplification of \i{MAF}. Included in the table is the length in base pairs (bp) of the generated fragment and the conditions used for each PCR reaction.} \box{\pre{ Fragment Primer name Primer sequence 5'-3' length PCR conditions ----------- ----------------------- -------- ---------------------------------- MAF_ex1.5f2 AGCTGGTGACCATGTCTGTG 407 bp Qiagen HotStart Taq + Q-solution: MAF_ex 1.5R AGAACTAGCAAGCCCACACC Predenat: 98\deg C, 5 min; denat: 96\deg C, 30 s; ann. 53.5\deg C, 30 s, ext. 72\deg C, 40 cycles MAF_ex 1.3F AACTGGCAATGAGCAACTCC 548 bp Qiagen HotStart Taq + Q-solution: MAF_ex 1.3R GTGGTGGTGGTGGTGGTAGT Predenat: 98\deg C, 5 min; denat. 96\deg C, 30 s; ann. 60\deg C, 30 s, ext. 72\deg C, 40 cycles MAF_ex1.2f2 GAGCGAGGGAGCACATTG 352 bp Qiagen HotStart Taq + Q-solution: MAF_ex 1.2r CCGGTTCCTTTTTCACTTCA Predenat: 98\deg C, 5 min; denat. 96\deg C, 30 s; ann. 60\deg C, 30 s, ext. 72\deg C, 40 cycles MAF_ex1.4f3 CCGCACTACCACCACCAC 432 bp Qiagen HotStart Taq + Q-solution: MAF_ex 1.4R CTGGTTCTTCTCCGACTCCA Predenat: 98\deg C, 5 min; denat. 96\deg C, 30 s; ann. 60\deg C, 30 s, ext. 72\deg C, 40 cycles MAF_ex2f AAATCCTGAGTAAGTGCCATTCA 575 bp New England Biolab Taq: MAF_ex2r GTTGCATTCCGGGAAACTT Predenat: 95\deg C, 5 min; denat. 95\deg C, 30 s; ann. 60\deg C, 30 s, ext. 72\deg C, 40 cycles }} }