\set{final} \def\Author{Liskova} \def\author{liskova} \def\vol{13} \def\year{2007} \def\anum{147} \def\pages{1339-1347} \def\txt_title{Study of p.N247S KERA mutation in a British family with cornea plana} \def\txt_authors{Petra Liskova, Pirro G. Hysi, Denise Williams, John R. Ainsworth, Sunil Shah, Albert de la Chapelle, Stephen J. Tuft, Shomi S. Bhattacharya} \def\rcvd{21 February 2007} \def\accept{26 July 2007} \def\publ{27 July 2007} \def\pdfsize{} \def\PMID{} \include{mvstyle.hsm} \| External links \def\primer3{http://www- genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi} \def\ncbi{http://www.ncbi.nlm.nih.gov} \def\dbsnp{http://www.ncbi.nlm.nih.gov/SNP/} \def\hapmap{http://www.hapmap.org/} \| Internal defs \article{ \title{Study of p.N247S \i{KERA} mutation in a British family with cornea plana} \authors{\mailto{baziliska@email.cz}{Petra Liskova},\sup{1,2,3} \mailto{p.hysi@ich.ucl.ac.uk}{Pirro G. Hysi},\sup{4,5} \mailto{DENISE.WILLIAMS@bwhct.nhs.uk}{Denise Williams},\sup{6} \mailto{j.r.ainsworth@bham.ac.uk}{John R. Ainsworth},\sup{7} \mailto{p.f.shah@talk21.com}{Sunil Shah},\sup{8} \mailto{albert.delachapelle@osumc.edu}{Albert de la Chapelle},\sup{9} \mailto{s.tuft@ucl.ac.uk}{Stephen J. Tuft},\sup{2} \mailto{smbcssb@ucl.ac.uk}{Shomi S. Bhattacharya} \sup{1}} \institutions{\sup{1}Division of Molecular Genetics, Institute of Ophthalmology, UCL, London, UK; \sup{2}Moorfields Eye Hospital NHS Foundation Trust, London, UK; \sup{3}Laboratory of the Biology and Pathology of the Eye and Ocular Tissue Bank, Institute of Inherited Metabolic Diseases, General Teaching Hospital and 1st Medical Faculty of Charles University, Prague, Czech Republic; \sup{4}Department of Epidemiology and Biostatistics, Institute of Child Health, UCL, London, UK; \sup{5}Department of Anesthesia, University of California at San Francisco, CA; \sup{6}Birmingham Women's Hospital, NHS Foundation Trust, Birmingham, UK; \sup{7}Eye Department, Birmingham Children's Hospital, NHS Foundation Trust, Birmingham, UK; \sup{8}Birmingham and Midland Eye Centre, City Hospital, NHS Foundation Trust, Birmingham, UK; \sup{9}Human Cancer Genetics Program, Comprehensive Cancer Center, The Ohio State University, Columbus, OH} \correspondence{Petra Liskova,Division of Molecular Genetics,Institute of Ophthalmology,University College London,11-43 Bath Street,London, EC1V 9EL, UK; Phone: +44 2076086800; FAX: +44 2076086863; email: p.liskova@ucl.ac.uk} \abstract \abs_purpose{To report clinical and genetic findings in a white British family with autosomal recessive cornea plana (CNA2) with a negative history for consanguinity. To look for evidence of a common ancestry with previously reported Finnish CNA2 patients by studying haplotypes.} \abs_methods{Clinical examination and direct sequencing of the \i{keratocan} (\i{KERA}) gene was performed in two siblings affected with CNA2 and one unaffected parent. We also studied 22 single nucleotide polymorphisms distributed in the \i{KERA} genomic region by direct sequencing in this family as well as in one additional Finnish patient with CNA2 and 24 white British control subjects.} \abs_results{Both siblings had the homozygous c.740A\gt G mutation leading to a p.N247S amino acid change originally reported as the founder mutation in 35 Finnish families. Genetic characterization of genomic regions surrounding the gene revealed large linkage disequilibrium, but the presence of shared extended haplotypes between affected individuals from Finland and the United Kingdom is consistent with a recent common ancestor.} \abs_conclusions{This is the first description of recessive cornea plana in a white British family and it is the second report on the p.N247S change in the \i{KERA} gene. Extended haplotype analysis suggests that the two geographically remote occurrences of the c.740A\gt G mutation may have a common origin.} \introduction \p{Cornea plana is a rare disorder in which the cornea is flattened with a low refractive power. Other features include microcornea, central corneal opacity, a widened corneal limbus, early arcus senilis, shallow anterior chamber, iris hypoplasia, corectopia, and peripheral anterior synechiae. Closed-angle glaucoma may also be present [1-3]. It can be inherited as an autosomal dominant (CNA1, OMIM \omim{121400}) or a clinically more severe autosomal recessive trait (CNA2, OMIM \omim{217300}) [3]. CNA2 is found worldwide with a high prevalence among the Finnish population [1]. Both CNA1 and CNA2 have been mapped to the long arm of chromosome 12 (12q21). Nonsynonymous or protein-truncating mutations of the \i{keratocan} (\i{KERA}) gene (OMIM \omim{603288}) have been identified as the cause of CNA2 but not CNA1 [4,5]. In some CNA1 families, linkage to the 12q21 locus was excluded [6].} \p{\i{KERA} codes for keratocan, a small-sized highly conserved leucine-rich protein that is expressed in cornea as well as in other tissues [4,7]. In \i{KERA} knockout mice there is a thinner corneal stroma and a narrower cornea-iris angle than in the wild type with less organized packing and larger diameters of stromal collagen fibrils on transmission electron microscopy [8].} \p{Overall, seven different mutations in the coding sequence of the \i{KERA} gene have been described in CNA2 families; 46 Finnish patients from 35 unrelated pedigrees were shown to have the c.740A\gt G (p.N247S) change inherited from a common founding ancestor [4]. In the same report one Chinese-American patient, born to consanguineous parents, was homozygous for p.Q174X [4]. Other sequence variants have also been reported, such as a consanguineous family originating from Bangladesh presenting with a combined phenotype of CNA2 and microphthalmia had a p.T215K change [9], one Hispanic consanguineous pedigree was shown to have p.N131D [10], while p.R313X, p.R279X, and p.C343fs were described in 14 consanguineous Arab families [11-13]. An affected member of one of the Arab families reportedly exhibited the cornea plana phenotype as well as superior pellucid marginal degeneration [12]. Bilateral progressive corneal ectasia leading to the development of a presumed unilateral hydrops and bilateral high astigmatism has also been described in recessive cornea plana [14].} \p{We describe a white British CNA2 family with two affected members. One sibling showed typical cornea plana phenotype and the other, in addition, had high simple astigmatism. Marker haplotypes in the \i{KERA} genomic region were studied to determine if the observed p.N247S mutation was identical by descent to those in the previously described Finnish families [4].} \methods \subsection{Patients and clinical examination} \p{The research complied with the tenets of the Declaration of Helsinki. Appropriate consent was obtained from participating subjects. The family was white British with no known foreign ancestry. Family members reported a negative family history for consanguinity in at least two preceding generations. The proband was a 26-year-old female (individual II:3) with poor vision since birth. Her 30-year-old sister (individual II:1) had similar phenotype, but the proband's brother, nephews, and parents were all normal (\figref{1}{A}). Standard ophthalmic examination, which included best corrected visual acuity, intraocular pressure measurement, and slit lamp biomicroscopy, was performed in the two affected siblings and their mother. Anterior segment photographs were taken of the affected siblings. Corneal horizontal diameters (white-to-white), corneal topography, pachymetry, and anterior chamber depth (ACD) measurements were performed using an Orbscan II operating under software version 3.12 (Bausch \and\ Lomb, Rochester, NY).} \subsection{DNA preparation and \i{keratocan} mutation screening} \p{Genomic DNA was extracted from venous blood samples using Nucleon\tm\ BACC3 genomic DNA extraction kit (GE Healthcare, Bucks, UK). The coding regions and exon-intron boundaries of the \i{KERA} gene were amplified by polymerase chain reaction (PCR) using sets of four primers (\tabref{1}). Primers were designed with \hot{\primer3}{Primer 3} program. Each PCR reaction consisted of approximately 50 ng of genomic DNA, 50 pmol of each primer and 12.5 \mu l of ReddyMix\sup{TM} PCR master mix (1.5 mM MgCl\sub{2}; ABgene, Epsom, UK) and water added up to a volume of 25 \mu l. After purification with Montage PCR\sub{96} Cleanup Kit (Millipore, Billerica, MA), samples were sequenced on an automated sequencer using dye-terminator chemistry under standard conditions with primers identical to those for genomic amplification (Applied Biosystems, Foster City, CA). Montage SEQ\sub{96} Sequencing Reaction Cleanup Kit (Millipore) was used for purification according to the manufacturer's instructions. Sequence data were aligned and analyzed by DNASTAR Lasergene sequence analysis software (DNAStar, Inc., Madison, WI) followed by manual inspection for base changes and comparison with database reference sequence \hot{\ncbi}{NCBI} accession \genbankdna{NM_007035}. Ninety-four unrelated white British control individuals were screened for the identified disease-causing mutation by direct sequencing. The DNA of these subjects was purchased from the European Collection of Cell Cultures (ECCAC, Porton Down, UK).} \subsection{Selection of polymorphisms and genotyping} \p{Thirty-three variations found on the Single Nucleotide Polymorphism \hot{\dbsnp}{dbSNP} database across 7.64 kb of the \i{KERA} genomic sequence were genotyped in the proband, an unaffected parent, and one Finnish subject with CNA2 previously described by Pellegata et al. [4]. All alleles were determined by direct sequencing of 290-492 bp long PCR fragments as described above. A list of the polymorphisms and appropriate primer sequences are shown in \tabref{2}. \hot{\ncbi}{NCBI} accession \genbankdna{NT_019546} was used as the reference sequence.} \p{To characterize linkage disequilibrium (LD) blocks in the \i{KERA} genomic region, we performed extended genotyping of 22 polymorphisms (one insertion/deletion polymorphism and 21 single nucleotide polymorphisms) by direct sequencing, not only in the British CNA2 family and Finnish CNA2 patient, but also in a subset of 24 white British control individuals (the same subjects were used for mutation screening). This was followed by haplotype comparison of a region spanning both sides of the \i{KERA} genomic sequence for a total of almost 280 kb. The genotyped polymorphic variants, their position, and the primers used for amplification of PCR fragments are shown in \tabref{3}. Selection of these polymorphisms was made to provide haplotypic information for wider regions of the chromosome and was made in ever increasing distances from \i{KERA} using the information from the \hot{\hapmap}{HapMap} publicly accessible databases.} \subsection{Haplotype Analysis} \p{Based on information about individual genotypes, haplotypes for each subject were reconstructed using PHASE [15], whereas the phylogenic tree was obtained using PHYLIP (version 3.2) [16] software and the upgraded package (version 3.6) as distributed by the author.} \results \p{The clinical characteristics of the proband were consistent with cornea plana (\tabref{4}). Both corneas appeared thin and flat, but simulated keratometry could only be obtained from the left eye (\figref{2}{C}). There was axial full thickness scarring in the right eye and bilateral mild peripheral corneal vascularization around a widened corneal limbus. Both anterior chambers were shallow. There was no other evidence of anterior segment dysgenesis. Intraocular pressures and fundus examination were normal. Individual II:1 (\figref{1}{A}) also had poor vision since birth. She had less severe hypermetropia than her sister but higher astigmatism (\tabref{4}). Both of her eyes had an abnormally broad limbus zone and arcus with more pronounced corneal thinning than her sister and mild bilateral anterior stromal scarring (\figref{2}{D,E}). The rest of the clinical examination was normal.} \p{Sequencing of the \i{KERA} gene in the affected individuals revealed homozygous c.740A\gt G substitution in exon 2 leading to asparagine to serine amino acid change at codon 247 (\figref{1}{B}). Consistent with autosomal recessive cornea plana, the parent was heterozygous for this change (\figref{1}{B}). The mutated allele was absent from 94 control subjects (188 chromosomes). Genotyping of 33 known simple genetic polymorphisms across the \i{KERA} gene (\tabref{2}) in both the British and Finnish patients, as well as the unaffected parent, revealed that these polymorphisms were identical except for the disease-causing mutation. Further characterization of alleles in the \i{KERA} genomic region in the patients, their available parent, and healthy controls is shown in \tabref{3} while the reconstructed haplotypes are shown in \tabref{5}.} \p{LD was strong over the extended genomic region. All three affected individuals shared exactly the same haplotype (\tabref{5}) for a 279 kb long genomic interval between the rs6144808 and rs826778 markers. Unaffected controls typically had a lower degree of LD with haplotype continuity broken beyond rs2701166 and rs516115. Organization of haplotypes in phylogenic trees (\figref{3}) shows the haplotype from the parent containing the mutation and the CNA2 patients forming a separate branch. The individual alleles in the diseased individuals remain in phase over the entire genomic interval studied. LD is not as strong and shows clear signs of decay at the extremities of the same interval in the controls' haplotypes (the pairwise LD between the two furthermost markers in our genotyped interval is only a modest D'=0.13; \figref{4}). Although not fully conclusive proof, this contrast is suggestive of a relatively recent common ancestor of all CNA2 cases of Finnish and British origin.} \discussion \p{Autosomal recessive cornea plana is a very rare disorder. It is most common in Finland where 78 cases have been identified. This represents the majority of cases reported worldwide [1]. We describe a new CNA2 family of British descent exhibiting a nonsynonymous amino acid substitution at codon 247 in the \i{KERA} gene. Prior to this study, this mutation has only been described in a cohort of 35 Finnish pedigrees (\figref{1}{B}) [4]. To our understanding, this is the first case of a p.N247S substitution outside Finland. The clinical characteristics of the two affected patients were consistent with CNA2. High astigmatism associated with superior pellucid marginal degeneration has previously been observed in one patient out of six affected members from a Saudi Arabian family with CNA2 [12]. Although we are unsure of the mechanism leading to the atypical topography pattern in patient II:1, there were no clinical features of pellucid marginal degeneration. Both patients had considerably less than average central corneal thickness measurements, but this did not increase toward the periphery. High astigmatism has also been reported in another Arab patient with progressive bilateral corneal ectasia [14]. Since serial observations have not been performed, we cannot comment whether there has been a progression of the corneal changes to possible ectasia in patient II:1.} \p{As patients with p.N247S changes have previously only been reported from a confined geographical area, we tried to determine whether there was a recent shared ancestry between the affected individuals from Finland and the United Kingdom. For this purpose, we attempted to collect haplotype information through the genotyping of single nucleotide polymorphisms. This class of molecular markers has the advantage of being more frequent than variable number tandem repeats and is transmitted from one generation to another with few, if any, modifications. The entire genomic region around \i{KERA} shows a generally high level of LD. By examining the single nucleotide polymorphisms and their combination in haplotypes, we found haplotypes containing the disease-causing change were perfectly conserved across the studied interval while the majority of haplotypes in healthy controls were not. A differential conservation of haplotypes adjacent to susceptibility loci and their susceptibility to natural selection has been observed in many occasions [17-21]. There may be two explanations for the observed conservation of both the structure and length of a specific haplotype: recent common ancestry or positive selection. Positive selection often results in extension of the size of the haplotype containing the beneficial allele. This possibility is unlikely since the extended haplotypes were observed in people affected with serious vision impairment.} \p{Although no conclusive proof can be produced with regards to the identity of descent by the cases examined here, the presence of haplotype sharing between affected individuals of both British and Finnish origin is suggestive of a common ancestor.} \acknowledgements \p{This work was supported by the Special Trustees of Moorfields Eye Hospital and research project MSM 0021620806-VZ-206100-11 (Ministry of Education of the Czech Republic).} \references \p{1. Forsius H, Damsten M, Eriksson AW, Fellman J, Lindh S, Tahvanainen E. Autosomal recessive cornea plana. A clinical and genetic study of 78 cases in Finland. Acta Ophthalmol Scand 1998; 76:196-203. \pubmed{9591953}} \p{2. Sigler-Villanueva A, Tahvanainen E, Lindh S, Dieguez-Lucena J, Forsius H. Autosomal dominant cornea plana: clinical findings in a Cuban family and a review of the literature. Ophthalmic Genet 1997; 18:55-62. \pubmed{9228241}} \p{3. Tahvanainen E, Forsius H, Karila E, Ranta S, Eerola M, Weissenbach J, Sistonen P, de la Chapelle A. Cornea plana congenita gene assigned to the long arm of chromosome 12 by linkage analysis. Genomics 1995; 26:290-3. \pubmed{7601455}} \p{4. Pellegata NS, Dieguez-Lucena JL, Joensuu T, Lau S, Montgomery KT, Krahe R, Kivela T, Kucherlapati R, Forsius H, de la Chapelle A. Mutations in KERA, encoding keratocan, cause cornea plana. Nat Genet 2000; 25:91-5. \pubmed{10802664}} \p{5. Tahvanainen E, Villanueva AS, Forsius H, Salo P, de la Chapelle A. Dominantly and recessively inherited cornea plana congenita map to the same small region of chromosome 12. Genome Res 1996; 6:249-54. \pubmed{8723718}} \p{6. Tahvanainen E, Forsius H, Kolehmainen J, Damsten M, Fellman J, de la Chapelle A. The genetics of cornea plana congenita. J Med Genet 1996; 33:116-9. \pubmed{8929947}} \p{7. Tasheva ES, Funderburgh JL, Funderburgh ML, Corpuz LM, Conrad GW. Structure and sequence of the gene encoding human keratocan. DNA Seq 1999; 10:67-74. \pubmed{10565548}} \p{8. Liu CY, Birk DE, Hassell JR, Kane B, Kao WW. Keratocan-deficient mice display alterations in corneal structure. J Biol Chem 2003; 278:21672-7. \pubmed{12665512}} \p{9. Lehmann OJ, El-ashry MF, Ebenezer ND, Ocaka L, Francis PJ, Wilkie SE, Patel RJ, Ficker L, Jordan T, Khaw PT, Bhattacharya SS. A novel keratocan mutation causing autosomal recessive cornea plana. Invest Ophthalmol Vis Sci 2001; 42:3118-22. \pubmed{11726611}} \p{10. Ebenezer ND, Patel CB, Hariprasad SM, Chen LL, Patel RJ, Hardcastle AJ, Allen RC. Clinical and molecular characterization of a family with autosomal recessive cornea plana. Arch Ophthalmol 2005; 123:1248-53. \pubmed{16157807}} \p{11. Khan A, Al-Saif A, Kambouris M. A novel KERA mutation associated with autosomal recessive cornea plana. Ophthalmic Genet 2004; 25:147-52. Erratum in: Ophthalmic Genet. 2004; 25:289. \pubmed{15370545}} \p{12. Khan AO, Aldahmesh M, Al-Saif A, Meyer B. Pellucid marginal degeneration coexistent with cornea plana in one member of a family exhibiting a novel KERA mutation. Br J Ophthalmol 2005; 89:1538-40. \pubmed{16234475}} \p{13. Khan AO, Aldahmesh M, Meyer B. Recessive cornea plana in the Kingdom of Saudi Arabia. Ophthalmology 2006; 113:1773-8. \pubmed{17011957}} \p{14. Khan AO, Aldahmesh M, Meyer B. Corneal ectasia and hydrops in a patient with autosomal recessive cornea plana. Ophthalmic Genet 2006; 27:99-101. \pubmed{17050286}} \p{15. Stephens M, Donnelly P. A comparison of bayesian methods for haplotype reconstruction from population genotype data. Am J Hum Genet 2003; 73:1162-9. \pubmed{14574645}} \p{16. Felsenstein J. PHYLIP - Phylogeny Inference Package (Version 3.2). Seattle: University of Washington; 1989. p. 164-6.} \p{17. Sabeti PC, Reich DE, Higgins JM, Levine HZ, Richter DJ, Schaffner SF, Gabriel SB, Platko JV, Patterson NJ, McDonald GJ, Ackerman HC, Campbell SJ, Altshuler D, Cooper R, Kwiatkowski D, Ward R, Lander ES. Detecting recent positive selection in the human genome from haplotype structure. Nature 2002; 419:832-7. \pubmed{12397357}} \p{18. Sabeti PC, Schaffner SF, Fry B, Lohmueller J, Varilly P, Shamovsky O, Palma A, Mikkelsen TS, Altshuler D, Lander ES. Positive natural selection in the human lineage. Science 2006; 312:1614-20. \pubmed{16778047}} \p{19. Zhang C, Bailey DK, Awad T, Liu G, Xing G, Cao M, Valmeekam V, Retief J, Matsuzaki H, Taub M, Seielstad M, Kennedy GC. A whole genome long-range haplotype (WGLRH) test for detecting imprints of positive selection in human populations. Bioinformatics 2006; 22:2122-8. \pubmed{16845142}} \p{20. Payseur BA, Cutter AD, Nachman MW. Searching for evidence of positive selection in the human genome using patterns of microsatellite variability. Mol Biol Evol 2002; 19:1143-53. \pubmed{12082133}} \p{21. Biswas S, Akey JM. Genomic insights into positive selection. Trends Genet 2006; 22:437-46. \pubmed{16808986}} \endreferences } \beginfigures \figfile{1}{ \figtitle{1}{Pedigree of the family with recessive cornea plana and c.740A\gt G mutation} \p{\panel{A}: Two affected family members are reported in this study. \panel{B}: Sequence data showing the homozygous c.740A\gt G mutation that leads to the p.N247S change in the British family, and one Finnish patient having a previously published founder effect for the same change [4].} \ctr{\gifimage{1}{800}{655}{153}} } \figfile{2}{ \figtitle{2}{Clinical findings in cornea plana family members} \p{The left eye of individual II:3 shows a diffuse opacity across the central cornea (\panel{A}), with (\panel{B}) a typically flat cornea seen in profile. \panel{C}: An Orbscan II map of the same eye (individual II:3). \panel{D}: The right eye of individual II:1 shows an arcus with a widened limbus with mild stromal opacity. Corneal flattening is less obvious than in individual II:3 (\panel{E}). An Orbscan II map of II:3 shows marked against-the-rule astigmatism (\panel{F}).} \ctr{\jpgimage{2}{800}{560}{310}} } \figfile{3}{ \figtitle{3}{Phylogenic tree of the observed haplotypes} \p{The tree is constructed from haplotypes of individuals from the British CNA2 pedigree, a published Finnish CNA2 patient [4] (all with p.N247S change), and 24 healthy white British controls. Haplotype numbers are the same as in \tabref{5}.} \ctr{\gifimage{3}{700}{495}{15}} } \figfile{4}{ \figtitle{4}{Heatmap plot of linkage disequilibrium (LD) over the \i{KERA} gene and surrounding genome in the control study panel} \p{Graphical representation of the linkage disequilibrium (LD) over the \i{KERA} gene and flanking region in the control panel is shown. The color filling of the cells represents the pairwise LD measured as D'. The bright-\color{\red}{red} color of the cells is indicative of the high LD, while the dark-\color{\blue}{blue} colors represent the least LD. Numbers inside the cells, when present, show the exact value of D' if it is not 1. Uninformative polymorphisms were not included.} \ctr{\gifimage{4}{800}{549}{101}} } \begintables \tabfile{1}{ \tabtitle{1}{Primer sequences used for the amplification of \i{KERA} coding region} \p{Four sets of primers were designed to cover the entire coding region within exons 2 and 3 of the \i{KERA} gene. The length of the PCR products ranged from 402 to 466 bp.} \box{\pre{ Amplicon Exon size number Primer sequences (5'-3') (bp) ------ --------------------------- -------- 2 TGTTGACATATTTTCACCTCTTCC 402 TCAAATGGCTTTTCAGGAATG GAGGTCTCAAAGAAATTCCTGCT 441 GCATATTCCTCAGGGCATTC GGACAATGCCTTTCAAAGAGAC GGGCAACACATTTGCTCTTC 441 3 TTGGGGGAAACAGATAGG GAAAATGGTGGCCGAGAGC 466 }} } \tabfile{2}{ \tabtitle{2}{Simple genetic polymorphisms genotyped across the \i{KERA} genomic sequence in the proband, an unaffected parent, and one Finnish subject} \p{Record identifiers (rsID) of 33 nucleotide variations found in the Single Nucleotide Polymorphism \hot{\dbsnp}{dbSNP} database with primer sequences used for amplification of sequenced PCR products, as well as their size are shown (range 290 to 492 bp).} \box{\pre{ Amplicon Polymorphism size number rsID Primer pairs (5'-3') (bp) ------------ ---------- -------------------------- -------- 1 \genbanksnp{rs10859101} CAATAAAAAGGACACATTTGTGTATG 423 TTTGCAGTTTAAGTGGATTTCA 2 \genbanksnp{rs11105952} same as \genbanksnp{rs10859101} 3 \genbanksnp{rs2464171} CATATTCCCCATTGCTCTCG 410 TCAAACTTGTACCACCAACAGC 4 \genbanksnp{rs2701166} TTGGGGGAAACAGATAGG 465 GAAAATGGTGGCCGAGAGC 5 \genbanksnp{rs2245775} GGCTTGAGTTCTTTGTCATTCA 488 TCCCCCAAACAAAAGTTCAG 6 \genbanksnp{rs1920771} same as \genbanksnp{rs2245775} 7 \genbanksnp{rs2268580} same as \genbanksnp{rs2245775} 8 \genbanksnp{rs2268579} same as \genbanksnp{rs2245775} 9 \genbanksnp{rs1920772} same as \genbanksnp{rs2245775} 10 \genbanksnp{rs2735341} same as \genbanksnp{rs2245775} 11 \genbanksnp{rs1920773} CCAGAATTCCCACAAAATGC 419 CATACAGGAGAGAAGGCCAGTT 12 \genbanksnp{rs2540006} same as \genbanksnp{rs1920773} 13 \genbanksnp{rs3216597} GAACTTGTCTTAAGCAATATGATGGA 415 TCACAGGCTTTATCAGCCAAT 14 \genbanksnp{rs17018619} TGCAATAGCCAGAACCTGAG 475 TGTTTCTCAGGGAACACCAG 15 \genbanksnp{rs11105956} TGTTTAGGAGTGAGGCAGCA 404 TTGTCCTTGGGCAAATATCC 16 \genbanksnp{rs2041711} GTTGTGCTGCCTGGGTATTA 410 ATTGTCCGTGGGGCTTTTA 17 \genbanksnp{rs2735337} GGGACTTACAGGCAATCGTC 492 AGCAGTTCCCAGTGGAAAAA 18 \genbanksnp{rs2735336} same as \genbanksnp{rs2735337} 19 \genbanksnp{rs2540004} same as \genbanksnp{rs2735337} 20 \genbanksnp{rs734722} ATCTGCAGCACCTTCACCTT 481 GTTTCAGGCATCAGCTGTCA 21 \genbanksnp{rs1920775} same as \genbanksnp{rs734722} 22 \genbanksnp{rs737111} GGACAATGCCTTTCAAAGAGAC 441 GGGCAACACATTTGCTCTTC 23 \genbanksnp{rs2735335} GAGGTCTCAAAGAAATTCCTGCT GCATATTCCTCAGGGCATTC 441 24 \genbanksnp{rs2735334} same as \genbanksnp{rs2735335} 25 \genbanksnp{rs2540003} same as \genbanksnp{rs2735335} 26 \genbanksnp{rs12320366} TGTTGACATATTTTCACCTCTTCC 402 TCAAATGGCTTTTCAGGAATG 27 \genbanksnp{rs2735333} same as \genbanksnp{rs12320366} 28 \genbanksnp{rs2701164} TTGAGAGGTTGAGCTAGAGAATAACA 431 TAGGCACCATATGCAAAGCA 29 \genbanksnp{rs1990550} GAGCCTGGGTCAATCCATTA 290 TGCCTTCCAGGAATACACC 30 \genbanksnp{rs1990549} same as \genbanksnp{rs1990550} 31 \genbanksnp{rs2735330} TCAGGAACAGATAAAATATGTCCA 489 TTCCACTTTGACAGGGCTTC 32 \genbanksnp{rs1990548} same as \genbanksnp{rs2735330} 33 \genbanksnp{rs2540002} same as \genbanksnp{rs2735330} }} } \tabfile{3}{ \tabtitle{3}{Genotyping of 22 polymorphisms located in the \i{KERA} genomic region} \p{Results obtained in British and Finnish CNA2 patients and in 24 white British control individuals (48 chromosomes) are shown. \hot{\dbsnp}{SNP} database record identifiers (rsID; when available) are shown in the second column and the chromosomal location is correlated to NCBI Build 36.1 human genome released update.} \box{\pre{ Alleles/ Alleles/ Alleles/ Amplicon number number number Polymorphism Chromosome position/ size CNA2 of of of number rsID location within a gene Primer pairs (5'-3') (bp) alleles controls controls controls ------------ ---------- ------------------------- --------------------------- -------- ------- -------- -------- -------- 1 \genbanksnp{rs6144808} 89920657..89920675 (plus) AGCTGGTAGCTTTCCTTCCA 415 del/del del/del del/ins ins/ins DSPG3 intron 1-2 CCAATGCCTAAGCCACACTG 1 12 11 2 \genbanksnp{rs2701166} 89969434 (minus) TTGGGGGAAACAGATAGG 465 t/t c/c c/t t/t KERA intron 2-3 GAAAATGGTGGCCGAGAGC 11 12 1 3 \genbanksnp{rs2245775} 89969619 (minus) GGCTTGAGTTCTTTGTCATTCA 488 t/t t/t t/a a/a KERA intron 2-3 TCCCCCAAACAAAAGTTCAG 21 1 2 4 \genbanksnp{rs1920771} 89969680 (plus) same as \genbanksnp{rs2245775} t/t t/t c/t c/c KERA intron 2-3 24 0 0 5 \genbanksnp{rs2268580} 89969685 (minus) same as \genbanksnp{rs2245775} t/t t/t t/c c/c KERA intron 2-3 23 1 0 6 novel 1 89969853 (minus) same as \genbanksnp{rs2245775} a/a a/a a/g g/g KERA intron 2-3 23 1 0 7 \genbanksnp{rs2041711} 89972017 (minus) GTTGTGCTGCCTGGGTATTA 410 g/g g/g g/t t/t KERA intron 2-3 ATTGTCCGTGGGGCTTTTA 21 1 2 8 \genbanksnp{rs734722} 89973043 (minus) ATCTGCAGCACCTTCACCTT 481 g/g g/g g/a a/a KERA intron 2-3 GTTTCAGGCATCAGCTGTCA 22 2 0 9 \genbanksnp{rs1920775} 89973205 (plus) same as \genbanksnp{rs734722} g/g g/g g/a a/a KERA intron 2-3 24 0 0 10 \genbanksnp{rs737111} 89973486 (minus) GGACAATGCCTTTCAAAGAGAC 441 t/t t/t g/t g/g KERA intron 2-3 GGGCAACACATTTGCTCTTC 24 0 0 11 \genbanksnp{rs12320366} 89974115 (plus) TGTTGACATATTTTCACCTCTTCC 402 c/c c/c c/t t/t KERA exon 2 TCAAATGGCTTTTCAGGAATG 23 1 0 12 \genbanksnp{rs2735333} 89974121 (minus) same as \genbanksnp{rs12320366} a/a a/a a/g g/g KERA exon 2 22 0 2 13 \genbanksnp{rs1990550} 89975774 (minus) GAGCCTGGGTCAATCCATTA 290 a/a a/a a/c a/a KERA 5' UTR- exon 1 TGCCTTCCAGGAATACACC 22 1 1 14 \genbanksnp{rs1990549} 89975775 (minus) same as \genbanksnp{rs1990550} g/g g/g g/a a/a KERA 5' UTR- exon 1 22 1 1 15 \genbanksnp{rs1990548} 89976072 (minus) TCAGGAACAGATAAAATATGTCCA 489 a/a a/a a/c c/c KERA 5' UTR- exon 1 TTCCACTTTGACAGGGCTTC 23 1 0 16 novel 2 89976073 (minus) same as \genbanksnp{rs1990548} t/t t/t t/c c/c KERA 5' UTR- exon 1 23 1 0 17 novel 3 89996330 (minus) AGGCAGCAGTCTGTCAGGTT 401 t/t t/t c/t c/c GTCCTTGATAAAGATGAAAGCAAA 20 3 1 18 \genbanksnp{rs1920726} 89996495 (minus) same as novel 3 g/g g/g g/a a/a 22 0 2 19 \genbanksnp{rs3759222} 90031084 (minus) TCTCAGCTCCATCCTGTTCA 402 c/c c/c a/c a/a TGGTATTTATAACAGACCTCAAATGC 22 0 2 20 \genbanksnp{rs516115} 90081423 (minus) GGATTATGCATGCTGTGTCCT 449 a/a a/a g/a g/g DCN intron 4 GGGTTGGTCATTTCCCTTGT 17 7 0 21 \genbanksnp{rs566806} 90083328 (minus) TCCTACTTCAATATGAAACAATGAAAA 433 c/c c/c c/t t/t DCN intron 3 TTGTGGCAGGATCTTGAAAA 17 7 0 22 \genbanksnp{rs826778} 90199860 (plus) TTCCATAGCACAGGACCA CA 467 a/a a/a c/a c/c TTGGGAACCGTTCTTTTCTG 15 8 1 }} } \tabfile{4}{ \tabtitle{4}{Clinical examination of two siblings with cornea plana} \p{Biometric characteristics, best corrected visual acuity, and refractive error of affected family members. The corneal horizontal diameter, simulated keratometry, and thinnest pachymetry of the right eye of individual II:3 are not shown due to the insufficient quality of the obtained Orbscan. Abbreviations: RE, right eye; LE, left eye.} \box{\pre{ Corneal Best horizontal corrected Thinnest Anterior diameter visual pachymetry chamber (mm) acuity Simulated keratometry (D) Refractive errors (D) (\mu m) depth (mm) ----------- ----------- -------------------------- ------------------------------------ ---------- ----------- Individual RE LE RE LE RE LE RE LE RE LE RE LE ---------- ---- ---- ---- ---- ------------ ----------- ----------------- ---------------- --- ---- ---- ---- II:1 11.1 11.4 6/45 6/45 49.7 at 180\deg\ 57.1 at 2\deg\ +0.50/-5.00x115\deg\ -5.50/-3.50x70\deg\ 212 107 3.21 3.25 33.4 at 90\deg\ 37.0 at 92\deg\ II:3 - 11.0 6/21 6/21 - 30.1 at 99\deg\ +14.00/-2.00x130\deg\ +6.50/-1.00x130\deg\ - 227 1.76 26.3 at 9\deg\ }} } \tabfile{5}{ \tabtitle{5}{Haplotypes on and around \i{KERA} gene} \p{Haplotypes for the genomic region of the \i{KERA} gene obtained by genotyping 22 nucleotide variations (results extrapolated to number 1 or 2) were reconstructed in the proband, parent, a member of a previously described CNA2 Finnish pedigree [4], and 24 white British controls. Twelve different haplotype types were recorded in total.} \ctr{\gifimage{4}{900}{1533}{142}} }