Table 1 of Tang, Mol Vis 2007; 13:534-544.


Table 1. Genotyping of MYOC microsatellites and single nucleotide polymorphisms

Forward primers that amplified microsatellites (MS) were labeled with fluorescein (FLU). Four single nucleotide polymorphisms (SNPs) were genotyped by assay-on-demand TaqMan. Only assay identifications and allele-specific probe signals were provided by the manufacturer. All allele-specific probes were labeled with a reporter dye (either VIC or FAM) at the 5' end, and a quencher and a minor groove-binder (MGB) at the 3' end. Bases in square brackets indicate the positions of the bases defining the alleles of the SNPs that were to be detected by the probes.

                                                                      5'-3' Sequence/allele
 Marker      Marker type/assay method     Primer/probe/assay ID          (probe signal)
---------   --------------------------   -----------------------   ---------------------------

NGA17       MS/Fragment analysis         Myocpm-F                  FLU-GGCTGTTATTTTTCTCTGT
                                         Myocpm-R                  TGCCAGCAAGATTCTTAGAA

NGA19       MS/Fragment analysis         Myoc3pm-F                 FLU-GTTGGGAGATGTGATTGCAG
                                         Myoc3pm-R                 AGATGGAGGTGGGAAAGTGT

rs7523603   SNP/TaqMan Assay-by-Design   Myocil-F                  CGGACCCAGAGCGAAGTT
                                         Myocil-R                  AGGGCTGTGGAAAGGTTATGG
                                         A allele-specific probe   VIC-CTGTGAGGTCAC[A]GAAG-MGB
                                         G allele-specific probe   FAM-TGTGAGGTCAC[G]GAAG-MGB

rs2075537   SNP/TaqMan Assay-on-Demand   C_27532255_10                T (VIC) and G (FAM)

rs235920    SNP/TaqMan Assay-on-Demand   C_558534_10                  T (VIC) and C (FAM)

rs2421853   SNP/TaqMan Assay-on-Demand   C_11335131_10                A (VIC) and G (FAM)

rs235858    SNP/TaqMan Assay-on-Demand   C_2964922_10                 A (VIC) and G (FAM)

Tang, Mol Vis 2007; 13:534-544 <http://www.molvis.org/molvis/v13/a57/>
©2007 Molecular Vision <http://www.molvis.org/molvis/>
ISSN 1090-0535