Table 1 of
Tang, Mol Vis 2007;
13:534-544.
Table 1. Genotyping of MYOC microsatellites and single nucleotide polymorphisms
Forward primers that amplified microsatellites (MS) were labeled with fluorescein (FLU). Four single nucleotide polymorphisms (SNPs) were genotyped by assay-on-demand TaqMan. Only assay identifications and allele-specific probe signals were provided by the manufacturer. All allele-specific probes were labeled with a reporter dye (either VIC or FAM) at the 5' end, and a quencher and a minor groove-binder (MGB) at the 3' end. Bases in square brackets indicate the positions of the bases defining the alleles of the SNPs that were to be detected by the probes.
5'-3' Sequence/allele Marker Marker type/assay method Primer/probe/assay ID (probe signal) --------- -------------------------- ----------------------- --------------------------- NGA17 MS/Fragment analysis Myocpm-F FLU-GGCTGTTATTTTTCTCTGT Myocpm-R TGCCAGCAAGATTCTTAGAA NGA19 MS/Fragment analysis Myoc3pm-F FLU-GTTGGGAGATGTGATTGCAG Myoc3pm-R AGATGGAGGTGGGAAAGTGT rs7523603 SNP/TaqMan Assay-by-Design Myocil-F CGGACCCAGAGCGAAGTT Myocil-R AGGGCTGTGGAAAGGTTATGG A allele-specific probe VIC-CTGTGAGGTCAC[A]GAAG-MGB G allele-specific probe FAM-TGTGAGGTCAC[G]GAAG-MGB rs2075537 SNP/TaqMan Assay-on-Demand C_27532255_10 T (VIC) and G (FAM) rs235920 SNP/TaqMan Assay-on-Demand C_558534_10 T (VIC) and C (FAM) rs2421853 SNP/TaqMan Assay-on-Demand C_11335131_10 A (VIC) and G (FAM) rs235858 SNP/TaqMan Assay-on-Demand C_2964922_10 A (VIC) and G (FAM) |